ID: 1024555434

View in Genome Browser
Species Human (GRCh38)
Location 7:50599510-50599532
Sequence GCAGATAATGGGATTGATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 314}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024555434_1024555440 17 Left 1024555434 7:50599510-50599532 CCTGAATCAATCCCATTATCTGC 0: 1
1: 0
2: 1
3: 34
4: 314
Right 1024555440 7:50599550-50599572 GCGCTCCAGCAGCCTAAGGCGGG 0: 1
1: 0
2: 1
3: 12
4: 199
1024555434_1024555442 23 Left 1024555434 7:50599510-50599532 CCTGAATCAATCCCATTATCTGC 0: 1
1: 0
2: 1
3: 34
4: 314
Right 1024555442 7:50599556-50599578 CAGCAGCCTAAGGCGGGAGCTGG No data
1024555434_1024555437 -9 Left 1024555434 7:50599510-50599532 CCTGAATCAATCCCATTATCTGC 0: 1
1: 0
2: 1
3: 34
4: 314
Right 1024555437 7:50599524-50599546 ATTATCTGCATTTCTGTGTGTGG 0: 1
1: 0
2: 1
3: 48
4: 461
1024555434_1024555439 16 Left 1024555434 7:50599510-50599532 CCTGAATCAATCCCATTATCTGC 0: 1
1: 0
2: 1
3: 34
4: 314
Right 1024555439 7:50599549-50599571 AGCGCTCCAGCAGCCTAAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 193
1024555434_1024555438 13 Left 1024555434 7:50599510-50599532 CCTGAATCAATCCCATTATCTGC 0: 1
1: 0
2: 1
3: 34
4: 314
Right 1024555438 7:50599546-50599568 GTTAGCGCTCCAGCAGCCTAAGG 0: 1
1: 0
2: 1
3: 2
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024555434 Original CRISPR GCAGATAATGGGATTGATTC AGG (reversed) Intronic
901946013 1:12704290-12704312 GCAGGTAATCGGAATGAGTCAGG + Intergenic
902052204 1:13572868-13572890 GCAGATAATTGGAATGAGTTAGG - Intergenic
903311284 1:22458514-22458536 GTAGATAATGGCATTGCTACTGG - Intronic
903635058 1:24807605-24807627 GCAGGTAATTGGAATGAGTCAGG + Intronic
904713589 1:32449739-32449761 GCAGGTAATCGGAATGAGTCAGG + Intergenic
904713593 1:32449767-32449789 GCAGGTAATTGGAATGAGTCAGG + Intergenic
904861130 1:33538824-33538846 GCAGTTAATGAGAATGTTTCTGG - Intronic
906506585 1:46384112-46384134 GCAGGTAATTGGAATGAGTCAGG + Intergenic
907709348 1:56864242-56864264 GTAGATAATTGGATTCATTCAGG + Intronic
908553279 1:65231280-65231302 ACAGATAATGGCATTTATTCTGG - Exonic
909238630 1:73183525-73183547 GCAGGTAATGGGAATGAGTCAGG - Intergenic
909238636 1:73183553-73183575 GCAGGTAAAGGGAATGAGTCAGG - Intergenic
909238642 1:73183581-73183603 GCAGGTAATGGGAATGAGTCAGG - Intergenic
909238648 1:73183609-73183631 GCAGGTAATGGGAATGAGTCAGG - Intergenic
909238660 1:73183693-73183715 GCAGGTAATGGGAATGAGTCAGG - Intergenic
909238666 1:73183721-73183743 GCAGGTAAAGGGAATGAGTCAGG - Intergenic
909238672 1:73183749-73183771 GCAGGTAATGGGAATGAGTCAGG - Intergenic
909238678 1:73183777-73183799 GCAGGTAATGGGAATAAGTCAGG - Intergenic
909238692 1:73183861-73183883 GCAGGTAATGAGAATGAGTCAGG - Intergenic
909238696 1:73183889-73183911 GCAGATAATCGGAATGACTCAGG - Intergenic
911178982 1:94844274-94844296 GAAGATAATGAATTTGATTCAGG + Intronic
911964405 1:104348383-104348405 CCATACAATGGGATTAATTCTGG - Intergenic
912989751 1:114473596-114473618 GCAGGTAATTGGAATGAGTCAGG + Intronic
915085565 1:153386247-153386269 GCAGAAAATGGGCTGGGTTCTGG + Intergenic
915085846 1:153388205-153388227 GCAGAAAATGGGCTGGGTTCTGG + Intergenic
916950633 1:169776826-169776848 GCAGATAGTGGGATTTAAACAGG - Intronic
917888004 1:179406577-179406599 GAAGATAAAGGGATCAATTCAGG - Intronic
918444690 1:184605582-184605604 CCAGATAATTGGATTGATAGAGG + Intronic
919525594 1:198645705-198645727 GCAGATAAAGGGATAGTTTAAGG + Intronic
920080033 1:203366428-203366450 ACAGATAAGGAGATTGATCCGGG + Intergenic
920741008 1:208581475-208581497 GCAGCTGATGGGATTCCTTCTGG + Intergenic
921985648 1:221309062-221309084 GCAGATACTGGGAGTGAGTAAGG + Intergenic
923420900 1:233813870-233813892 AAGGATAATGGGATTGACTCTGG + Intergenic
924039363 1:239968817-239968839 GTAGATATTTGGATTGATTCTGG - Intergenic
924875626 1:248100220-248100242 GTAGATAATGGGATTGAGCATGG - Exonic
1063946661 10:11182733-11182755 GCAGATAATGTGTTTGGTTTTGG - Intronic
1064773735 10:18752586-18752608 GCAGGTAATCGGAATGAGTCAGG - Intergenic
1064827383 10:19420263-19420285 GCAGGTAATCGGAATGAGTCAGG + Intronic
1065109364 10:22424829-22424851 CCATATAATGGCATTGATTTAGG - Intronic
1065810586 10:29439155-29439177 GCAGGTAATTGGAATGAGTCAGG + Intergenic
1065810594 10:29439211-29439233 GCAGGTAATCGGATTGAGTCAGG + Intergenic
1065864360 10:29900886-29900908 GCATCCAATGGGATTGATACTGG + Intergenic
1067907594 10:50309833-50309855 GCAGATAACAGGATGGATTATGG - Intronic
1068985126 10:63101221-63101243 GCAGGTAATCGGAATGAGTCGGG - Intergenic
1070416390 10:76193980-76194002 ACAAATAATGGCATTTATTCAGG + Intronic
1070457942 10:76635534-76635556 GAAGATAATGAGAGAGATTCTGG - Intergenic
1071060426 10:81564239-81564261 GCAGATAATGGGAAGAATTGTGG + Intergenic
1071282900 10:84118848-84118870 GCAGGTAATGGGAATGAGTCAGG + Intergenic
1071283906 10:84126591-84126613 GCAGGTAATGGGAATGAGTCAGG + Intergenic
1075217685 10:120552862-120552884 GCAGTTGATGGAATTGATGCAGG + Intronic
1075899129 10:126024806-126024828 ACACTAAATGGGATTGATTCAGG + Intronic
1077937506 11:6803002-6803024 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1078176093 11:8972174-8972196 TCAGATAATGAGATAGATTATGG + Intergenic
1078723917 11:13910713-13910735 GGATTTAATGGGAATGATTCTGG - Intergenic
1079271238 11:18987760-18987782 GCAGGTAATTGGAATGAGTCAGG + Intergenic
1080580866 11:33642623-33642645 GCAGGTAATTGGAATGAGTCAGG + Intronic
1080580874 11:33642679-33642701 GCAGGTAATCGGAATGAGTCAGG + Intronic
1080580879 11:33642707-33642729 GCAGGTAATTGGAATGAGTCAGG + Intronic
1081345359 11:41979138-41979160 GCAGGTAATTGGAATGAGTCAGG - Intergenic
1081919418 11:46758971-46758993 GGAGATAATGAAATTGATTGTGG + Exonic
1084512464 11:69614735-69614757 GAAGATAAAGGGCTTGATTGGGG + Intergenic
1086510815 11:87555865-87555887 GCAGGTAATTGGAATGAGTCAGG + Intergenic
1086510820 11:87555893-87555915 GCAGGTAATCGGAATGAATCAGG + Intergenic
1086591208 11:88516311-88516333 ACAGACAATGGGAATGACTCTGG - Intronic
1086634717 11:89066756-89066778 ACAGACAAGGGGATTGATGCTGG + Intergenic
1086825331 11:91489194-91489216 GCAGGTAATTGGAATGAGTCAGG + Intergenic
1087639850 11:100745117-100745139 GCAGGTAATGGGAATAAGTCAGG + Intronic
1090231293 11:125106904-125106926 GCAGATATTTGGATTGTTTAAGG - Intronic
1090258502 11:125302577-125302599 GCAGCCAAGGGGATTGAGTCAGG + Intronic
1090950451 11:131468320-131468342 GCAGATAATGTGAATGGTTGAGG + Intronic
1091117264 11:133025110-133025132 GAGGAAAATGGGATTGATTTGGG + Intronic
1091180093 11:133596475-133596497 CCAGAGAAGGGGATTGAGTCTGG - Intergenic
1092341770 12:7682757-7682779 GGAGATAATCTGATTCATTCAGG + Intergenic
1092589118 12:9934173-9934195 ACAGAGAATGGCATTTATTCTGG - Intergenic
1094277766 12:28697965-28697987 TCAGATAAGGGGATTCTTTCTGG + Intergenic
1094475441 12:30837241-30837263 GCAGGTAATCGGAATGAGTCAGG - Intergenic
1094583788 12:31758491-31758513 GCAGGTAATGGGAATGAATCAGG - Intergenic
1094583799 12:31758547-31758569 GCAGGTAATGGGAATGAGTCAGG - Intergenic
1096513954 12:52146332-52146354 TCAGATGAAGGGATGGATTCAGG + Intergenic
1097715962 12:62966558-62966580 GCCGGTAATGGGAATGAGTCAGG - Intergenic
1097757165 12:63419333-63419355 GCAGGTAATTGGAATGAGTCAGG - Intergenic
1098547854 12:71731199-71731221 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1100716894 12:97315356-97315378 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1101387695 12:104272370-104272392 GCAGGTAATCGGAATGAGTCAGG + Intronic
1102031198 12:109741114-109741136 GCAGATGATGGGGATGATGCAGG + Intronic
1103593484 12:122008805-122008827 GCAGATAGTGGAAATAATTCAGG - Intergenic
1104194483 12:126520117-126520139 GCAGATAATGGGAGTAATTCAGG - Intergenic
1106477875 13:30113964-30113986 GCAGATAAAGAGTTTGCTTCAGG - Intergenic
1107374678 13:39789548-39789570 GCAGGTGATGGGAATGAGTCTGG - Intronic
1107565077 13:41594019-41594041 GCAGCTAATGGGATTGGGTAGGG - Intronic
1107990836 13:45817864-45817886 GCAGGTAAGAGGATAGATTCAGG - Intronic
1107997606 13:45876198-45876220 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1108734708 13:53270588-53270610 GCAGATGAAGGGATGAATTCAGG + Intergenic
1111888718 13:94054907-94054929 GCAGAGAATAAGATTAATTCGGG - Intronic
1112158676 13:96846323-96846345 GCAGATAATGAGTTTCATTTTGG - Intergenic
1113219555 13:108084557-108084579 GCAGTTAATCGGAATGAGTCAGG - Intergenic
1113524634 13:110965489-110965511 GCAGGTAATCGGAATGAGTCAGG - Intergenic
1113574221 13:111382714-111382736 GGAGATGATGGGGTTGTTTCAGG + Intergenic
1114235852 14:20823046-20823068 GCAGGTAATTGGAATGAGTCAGG + Intergenic
1114236550 14:20828719-20828741 GCAGGTAATTGGAATGAGTCAGG + Intergenic
1114513215 14:23279535-23279557 GCAGGTAATCGGAATGAGTCAGG + Intronic
1115239951 14:31244140-31244162 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1115590276 14:34857611-34857633 GGAGAGAATTGGATGGATTCAGG - Intronic
1116968024 14:51034752-51034774 GCAGTTAATAGCATGGATTCTGG + Intronic
1117179306 14:53176056-53176078 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1117179985 14:53181715-53181737 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1117179990 14:53181743-53181765 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1117179995 14:53181771-53181793 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1117180000 14:53181799-53181821 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1117180005 14:53181827-53181849 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1117180010 14:53181855-53181877 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1117573222 14:57069985-57070007 ACAGGTAGTGGGATTGATCCTGG + Intergenic
1118716065 14:68560952-68560974 GCAGAAAATGGGCCAGATTCAGG + Intronic
1121673716 14:95734379-95734401 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1121673721 14:95734407-95734429 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1123739587 15:23223961-23223983 GCAGATAATGATATTTTTTCAGG - Intergenic
1124290808 15:28452933-28452955 GCAGATAATGATATTTTTTCAGG - Intergenic
1127568757 15:60219923-60219945 GAAGATAATGGGCTTCATTTTGG - Intergenic
1129055600 15:72817749-72817771 GTAGACAATGTGATTGATACTGG - Intergenic
1129139168 15:73581581-73581603 CCAGATAATGAAATTGGTTCAGG - Intronic
1130342851 15:83013750-83013772 GCAGACAACTGGATTGATTCAGG + Intergenic
1134114781 16:11539675-11539697 GGAGACATTGGGTTTGATTCGGG - Intergenic
1136011508 16:27366499-27366521 GCAGCTAAAGGGATTGATTTTGG - Intergenic
1138205238 16:55119816-55119838 GCAGATGGTGGGATAGATCCTGG - Intergenic
1138296582 16:55890987-55891009 GCAGGTAATCGGAATGAGTCAGG - Intronic
1138296587 16:55891015-55891037 GCAGATAATCGGAATGAGTCAGG - Intronic
1138296591 16:55891043-55891065 GCAGGTAATTGGAATGAGTCAGG - Intronic
1140157546 16:72447820-72447842 GCAAGTAATGGGATTGACTAAGG - Intergenic
1140236686 16:73165591-73165613 GAAGTTAATGGGATTGACTCAGG - Intergenic
1142646289 17:1315827-1315849 CCAGGTAATGGGATTGAACCCGG + Intergenic
1144342472 17:14321283-14321305 GCAGCCTATTGGATTGATTCTGG + Intronic
1147581992 17:41632180-41632202 TCAGATATTGGGGTTGGTTCTGG - Intergenic
1148933339 17:51144953-51144975 ACAAAGAATGGAATTGATTCAGG - Intergenic
1149249171 17:54748615-54748637 TCAGATAATGTGATTCATCCAGG + Intergenic
1149799692 17:59555896-59555918 GGAGATAATGGTATTGTTACAGG - Intergenic
1151988539 17:77559214-77559236 GCGGAGAATGGGAGTGTTTCAGG + Intergenic
1153826093 18:8876291-8876313 GCAGGTAATCGGAATGAGTCAGG - Intergenic
1153936390 18:9928549-9928571 GCAGATTATTGGTTTAATTCAGG + Intronic
1154039100 18:10836155-10836177 GGAGATAAGGGGAGTGATCCTGG - Intronic
1155745967 18:29356652-29356674 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1155745975 18:29356708-29356730 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1155745983 18:29356764-29356786 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1155746643 18:29362431-29362453 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1155803827 18:30141739-30141761 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1155803831 18:30141767-30141789 GCAGGTAATTGGAATGAGTCAGG + Intergenic
1157338858 18:46760791-46760813 GCAGTGAATGAGATTGATGCTGG + Intergenic
1157758453 18:50240323-50240345 GCAGGTAATTGGAATGAGTCAGG - Intronic
1159127686 18:64244279-64244301 GAAGAGAAAGGGATTGGTTCTGG + Intergenic
1163927490 19:20360068-20360090 GCAGGTAATGGGAATGAGTCAGG - Intergenic
1163929527 19:20375727-20375749 GCAGGTAATGGGAATGAGTCAGG - Intergenic
1167907077 19:52670209-52670231 GCAGGTAATCGGAGTGAGTCAGG - Intronic
925176874 2:1792174-1792196 GCAGTTAATGGTATGGTTTCGGG + Intronic
925666126 2:6258112-6258134 GCAGAGAATTGGAATCATTCTGG + Intergenic
927213636 2:20653542-20653564 GCAGAAAATGGGATTGCTGTTGG - Intergenic
927528084 2:23767142-23767164 GCAGGTAATTGGAATGAGTCAGG - Intronic
928439883 2:31283612-31283634 GCAGGTAATCGGAATGAGTCAGG - Intergenic
928439888 2:31283640-31283662 GCAGGTAATCGGAATGAGTCAGG - Intergenic
928439895 2:31283694-31283716 GCAGGTAATCGGAATGAGTCAGG - Intergenic
932396237 2:71450503-71450525 AGAGAGAATGTGATTGATTCAGG + Intergenic
933507095 2:83191313-83191335 GCAGGTACTGGGGTTGATTTAGG - Intergenic
935395432 2:102603276-102603298 GCAGATATTTGGCCTGATTCAGG + Intergenic
939166332 2:138644955-138644977 GCAGGTAATCGGAATGAGTCAGG + Intergenic
939193553 2:138944730-138944752 GTAAATAATGAGATTGATTCTGG - Intergenic
940341000 2:152581451-152581473 GCAAATACTGGCACTGATTCTGG + Intronic
942470593 2:176255795-176255817 GCACCTAATGGCATTGACTCAGG + Intergenic
943154199 2:184152043-184152065 GCAGGTAATTGGAATGAGTCAGG - Intergenic
943851334 2:192726796-192726818 GAAGATAATCGCATTGATCCAGG + Intergenic
943864737 2:192915301-192915323 GCAGGTAATGGGAATGAGTTAGG + Intergenic
947556381 2:231096905-231096927 GCAGATGATCGGAATGAGTCAGG + Intronic
948138596 2:235656490-235656512 GCAGGTAATCGGAATGAGTCAGG - Intronic
948165823 2:235861752-235861774 GCTTATCAGGGGATTGATTCTGG + Intronic
948358526 2:237399952-237399974 GCTGATAATGAGATTGAGTCTGG - Intronic
948878599 2:240843478-240843500 GCAGGTGATGGGAATGAGTCAGG + Intergenic
1168823302 20:791920-791942 GCAGGTAATCGGAATGAGTCAGG - Intergenic
1168824469 20:800511-800533 GCAGGTAATCGGAGTGAGTCAGG - Intergenic
1168824474 20:800539-800561 GCAGGTAATCGGAGTGAGTCAGG - Intergenic
1168824479 20:800567-800589 GCAGGTAATCGGAGTGAGTCAGG - Intergenic
1168824484 20:800595-800617 GCAGGTAATCGGAATGAGTCAGG - Intergenic
1171765321 20:29263640-29263662 GCAGATAATTGGAGTGGTTTGGG + Intergenic
1172924541 20:38520445-38520467 AGAAATAATGGGACTGATTCAGG - Intronic
1173303338 20:41824439-41824461 GAATATAATTGGATTGTTTCTGG - Intergenic
1173343276 20:42174377-42174399 ATAGATAAAGGGATTGATTGAGG + Intronic
1178837332 21:36110004-36110026 GCAGGTAATCGGAATGAGTCAGG - Intergenic
1181629998 22:24145863-24145885 GAAGAAATTGGGATTGATTGTGG + Intronic
1203310123 22_KI270736v1_random:136935-136957 GCAGTTGATGGAATTGATTTGGG + Intergenic
950855592 3:16101689-16101711 GCAGGTGATTGGAATGATTCAGG + Intergenic
950855601 3:16101745-16101767 GCAGGTAATCGGAGTGAGTCAGG + Intergenic
950857485 3:16119351-16119373 GCAGATCATGGGAATGTCTCTGG + Intergenic
952764245 3:36941431-36941453 GCAAAAGATGGAATTGATTCAGG + Intronic
953972847 3:47360452-47360474 GCAGGTAATCGGAATGAGTCAGG + Intergenic
954481008 3:50801378-50801400 GCAGGTAATTGGAATGAGTCAGG + Intronic
954481012 3:50801406-50801428 GCAGATAATTGGAATGAGTCAGG + Intronic
954604317 3:51897084-51897106 GCAGGTAATGGGAATGAGTCAGG - Intronic
954604981 3:51902552-51902574 GCAGGTAATTGGAATGAGTCAGG - Intronic
957975125 3:87433553-87433575 GCAGGTAATTGGAATGAGTCAGG - Intergenic
961957410 3:130818284-130818306 GCAGGTAATTGGAATGAGTCAGG + Intergenic
963948356 3:151170810-151170832 GCAGGTAGTGGGAATGAGTCGGG + Intronic
964772749 3:160240980-160241002 GCAGGTAATTGGAATGAGTCAGG + Intronic
968111913 3:196055434-196055456 GCAGATAATGAGATAGAATTGGG - Intronic
968590050 4:1453440-1453462 GCAGATAATGGTAATGATGATGG - Intergenic
970092463 4:12426066-12426088 GCAGGTAATCGGAATGAGTCAGG + Intergenic
970092472 4:12426123-12426145 GCAGGTAATTGGACTGAGTCAGG + Intergenic
970093104 4:12431480-12431502 GCAGGTAATCGGAATGAGTCAGG + Intergenic
970093111 4:12431508-12431530 GCAGGTAATCGGAATGAGTCAGG + Intergenic
970331223 4:14986392-14986414 GCAGATAAGGAGATTGAAACTGG - Intergenic
970498959 4:16657318-16657340 GATGATGATGGGACTGATTCTGG - Intronic
971066813 4:23042376-23042398 GCAGGTAATCGGAATGAGTCAGG - Intergenic
972652410 4:41030913-41030935 GCAGACAATGGTATAAATTCTGG + Intronic
972785205 4:42320273-42320295 GCAGGTAATCGGAATGAGTCAGG - Intergenic
974409851 4:61525963-61525985 GCTGATAAAGAGATTGATTGGGG + Intronic
975083741 4:70311453-70311475 GCAGATAATGGTGTTGAGTGTGG + Intergenic
976133848 4:81913677-81913699 GCACATAATGAGGCTGATTCTGG - Intronic
976133863 4:81913735-81913757 GCACATAATGAGGCTGATTCTGG - Intronic
979425463 4:120559513-120559535 TCAGACAATGGTATTGATACAGG + Intergenic
979619810 4:122786466-122786488 GCAGGTAATTGGAATGAGTCAGG - Intergenic
979770728 4:124521759-124521781 GCAGGTAATTGGAATGAGTCAGG + Intergenic
980173838 4:129321347-129321369 GCATATAATAGGGTTGTTTCAGG - Intergenic
980439288 4:132818729-132818751 GCAGGTAATTGGAATGAGTCAGG + Intergenic
982724200 4:158888205-158888227 GGAGGCAATTGGATTGATTCAGG + Intronic
982823886 4:159978075-159978097 GCAGATAATCGGAATGAGTTAGG - Intergenic
987700198 5:21388100-21388122 GCAAATAATTGGAATGTTTCAGG + Intergenic
988038399 5:25857691-25857713 GCAGGTAATCGGAATGAGTCAGG + Intergenic
988507421 5:31835918-31835940 GGAAATAATAGGACTGATTCAGG - Intronic
993054811 5:82969442-82969464 GCAGGTAATTGGAATGAGTCAGG + Intergenic
993055606 5:82975944-82975966 GCAGGTAATTGGAGTGAGTCAGG + Intergenic
993055626 5:82976055-82976077 GCAGGTAATTGGAATGAGTCAGG + Intergenic
993500577 5:88661450-88661472 GCAGATAATCGACTTTATTCAGG - Intergenic
994622661 5:102181136-102181158 GCAGATAATTGGAATGAGTTAGG + Intergenic
995731645 5:115249574-115249596 GCAGGTAATCGGAATGAGTCAGG + Intronic
995731650 5:115249602-115249624 GCAGGTAATTGGAATGAGTCAGG + Intronic
995755975 5:115504560-115504582 GCAAATAATAGGATTTATTAAGG + Intergenic
995794663 5:115928872-115928894 GCAGGTAATCGGAATGAGTCAGG + Intergenic
995794668 5:115928900-115928922 GCAGGTAATCGGAATGAGTCAGG + Intergenic
995794681 5:115928984-115929006 GCAGGTAATCGGAATGAGTCAGG + Intergenic
995794690 5:115929040-115929062 GCAGGTAATCGGAATGAGTCAGG + Intergenic
995794695 5:115929068-115929090 GCAGGTAATCGGAATGAGTCAGG + Intergenic
995794700 5:115929096-115929118 GCAGGTAATCGGAATGAATCAGG + Intergenic
995794710 5:115929153-115929175 GCAGGTAATTGGAATGAGTCTGG + Intergenic
995794849 5:115930330-115930352 GCAGGTAATCGGAATGAGTCAGG + Intergenic
995794873 5:115930470-115930492 GCAGGTAATCGGAATGAGTCAGG + Intergenic
995805348 5:116046232-116046254 GCAGATAATGCCACTTATTCAGG - Intronic
998465988 5:142344276-142344298 GCAGAGAATAGGATTGCTTTAGG - Intergenic
998552247 5:143088893-143088915 GCAGATAATCGGAATGAGTCAGG + Intronic
998552254 5:143088921-143088943 GCAGGTAATGGGAATGAGTCAGG + Intronic
998552990 5:143094839-143094861 GCAGGTAATGGGAATGAGTCGGG + Intronic
998552995 5:143094867-143094889 GCAGGTAATCGGAATGAGTCAGG + Intronic
999527639 5:152424872-152424894 GCAGCAAATGGAATGGATTCAGG + Intronic
999789942 5:154930080-154930102 GCAGGTAATCGGAATGAGTCAGG - Intronic
1008104905 6:47430894-47430916 GCAGGTAATCGGAATGAGTCAGG - Intergenic
1008327580 6:50202819-50202841 ACAGACAATGGGATTGTTTCTGG - Intergenic
1009635357 6:66258797-66258819 GCAGATAATTGGAATGAGTTGGG - Intergenic
1009635362 6:66258825-66258847 GCAGGTAATTGGAATGAGTCAGG - Intergenic
1009635984 6:66264479-66264501 GCAGATAATCGGAATGTGTCAGG - Intergenic
1010397175 6:75405806-75405828 GCAGACAATCGGAATGAGTCGGG + Intronic
1011365884 6:86582097-86582119 GCCGATAATCGGAATGAGTCAGG + Intergenic
1011450328 6:87484700-87484722 GCAGGTAATCGGAATGAGTCAGG + Intronic
1011569935 6:88724798-88724820 GCAGGTAATGGGAATGAGTCAGG - Intronic
1011570592 6:88730258-88730280 GCAGGTAATGGGAATGAGTCAGG - Intronic
1011716340 6:90109053-90109075 GCAGAGAAAGGGATTGGTTCTGG - Intronic
1013814560 6:114082772-114082794 GCAGGTAATTGGAATGAGTCAGG - Intronic
1015457351 6:133441758-133441780 GCAGGTAATTGGAATGAGTCAGG + Intronic
1015521432 6:134135416-134135438 GCAGGTAATTGGAATGAGTCAGG + Intergenic
1016519305 6:144928963-144928985 GCAGATCACGTGATTGTTTCAGG - Intergenic
1016821899 6:148354689-148354711 GCAGAAAATGGGACTCATTGTGG + Intronic
1017270259 6:152495590-152495612 GCAGGTAATCGGAATGAGTCAGG - Intronic
1018181173 6:161225048-161225070 GCAGGTAATCGGAATGAGTCAGG - Intronic
1018191153 6:161310015-161310037 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1018191810 6:161315446-161315468 GCAGGTAATAGGAATGAGTCAGG + Intergenic
1018191822 6:161315530-161315552 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1018191827 6:161315558-161315580 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1018191832 6:161315586-161315608 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1018191841 6:161315644-161315666 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1018191850 6:161315702-161315724 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1018566118 6:165155607-165155629 AATGATTATGGGATTGATTCAGG - Intergenic
1019112594 6:169728124-169728146 GTGGATAATGGGGTTCATTCAGG + Intergenic
1020459922 7:8417852-8417874 GCAGGTAATCGGAATGAGTCAGG - Intergenic
1023436117 7:40142172-40142194 GCAGGTAATCGGAATGAGTCAGG + Intronic
1023436122 7:40142200-40142222 GCAGGTAATTGGAATGAGTCAGG + Intronic
1023443756 7:40210816-40210838 GCAGATAATTGGAATGAGTTAGG + Intronic
1023798496 7:43813381-43813403 GCAGGTGATTGGATTGAGTCAGG - Intergenic
1023799294 7:43819652-43819674 GCAGGTAATCGGAATGAGTCAGG - Intergenic
1024555434 7:50599510-50599532 GCAGATAATGGGATTGATTCAGG - Intronic
1026799284 7:73388705-73388727 GCAGGTAATCGGAATGATTCAGG + Intergenic
1027473743 7:78604451-78604473 GGAGATAATGGGATTCAGTATGG - Intronic
1028793916 7:94883028-94883050 GCAGGTAATCGGAATGAGTCAGG - Intergenic
1028965167 7:96793989-96794011 GAAGATAATGAGTTTGATTTGGG + Intergenic
1033096442 7:138435705-138435727 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1033096446 7:138435733-138435755 GCAGGTAATTGGAATGAGTCAGG + Intergenic
1033096820 7:138439459-138439481 GCAGATAATCAGAATGAGTCAGG + Intergenic
1033098446 7:138450492-138450514 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1034392444 7:150797373-150797395 AAAGAAAATGAGATTGATTCTGG + Intronic
1037010462 8:13836149-13836171 GCAGATCATAGCAGTGATTCTGG - Intergenic
1039240345 8:35549315-35549337 GGAGCTGATGGGATGGATTCGGG - Exonic
1041446250 8:57953994-57954016 TCAGATCATGGGACTGATCCTGG + Intergenic
1041919298 8:63165059-63165081 GCAGGTAATTGGAATGAGTCAGG - Intergenic
1042927801 8:73984222-73984244 GCAGGTAATTGGAATGAGTCAGG + Intergenic
1043604303 8:81981399-81981421 GCAGATAAAGGGTGTGGTTCAGG + Intergenic
1043720857 8:83545773-83545795 GCAGGTAATTGGAATGAGTCAGG + Intergenic
1044061062 8:87636369-87636391 GCAGGTAATCGGAATGACTCGGG - Intergenic
1044184325 8:89234219-89234241 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1044781381 8:95746894-95746916 GTAGATATTGGGAATGATTTGGG - Intergenic
1046038533 8:108874326-108874348 CCTCATAATGGGATTGTTTCAGG - Intergenic
1048881186 8:138874049-138874071 GCAGCTAGTGAGATTGAATCAGG - Intronic
1050442096 9:5675276-5675298 GCAGGTAATGGGAACGAGTCAGG + Intronic
1052648774 9:31273047-31273069 GCAGATGATTGGAATGAGTCAGG - Intergenic
1052648783 9:31273103-31273125 GCAGGTAATTGGAATGAGTCAGG - Intergenic
1052904280 9:33819322-33819344 GTAGGAAATGGGATTGATACAGG + Intronic
1053111305 9:35461917-35461939 GCAGGTAATTGGAATGATTTCGG + Intergenic
1053243681 9:36517254-36517276 GCAGACAATGGGATTGAACAGGG - Intergenic
1053344429 9:37367851-37367873 CCAGATAATGGCTATGATTCCGG + Intergenic
1056415091 9:86367818-86367840 GCAGGTAATTGGAATGAGTCAGG + Intergenic
1056464922 9:86844361-86844383 CCAAATAATGGGTTTGATTATGG + Intergenic
1056642243 9:88381480-88381502 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1056737319 9:89220792-89220814 TGAGATAATGGGGTTGATGCTGG - Intergenic
1057809987 9:98250366-98250388 GCAGAGAAGGGGATGGGTTCTGG + Intronic
1058099415 9:100902451-100902473 GCAGGTAATGGGCTTTATTGTGG + Intergenic
1058394344 9:104533169-104533191 GAAGATAGTGGGAATGATACAGG + Intergenic
1186025667 X:5308168-5308190 ACAGATGAAGGGATTGACTCAGG - Intergenic
1186057847 X:5669434-5669456 GCAGTTCAGGTGATTGATTCTGG + Intergenic
1186494846 X:10004293-10004315 GCACAAAAAGGGATTTATTCAGG + Intergenic
1187128597 X:16478868-16478890 GCAGACAACTGGATTGATTATGG + Intergenic
1189833099 X:44994882-44994904 GCAGGTAATTGGAATGAGTCAGG + Intronic
1190771810 X:53521075-53521097 GCAGGTAATCGGAATGAGTCAGG - Intergenic
1191586157 X:62828909-62828931 GAAAATGATGGGACTGATTCTGG + Intergenic
1191889739 X:65927633-65927655 GCAGGTAATTGGAATGAGTCAGG + Intergenic
1191890341 X:65932799-65932821 GCAGGTAATTGGAATGAGTCCGG + Intergenic
1191890349 X:65932855-65932877 GCAGGTAATTGGAATGAGTCAGG + Intergenic
1191890357 X:65932911-65932933 GAAGGTAATGGGAATGAGTCAGG + Intergenic
1192233789 X:69283721-69283743 GCAAGTAATGGGACAGATTCAGG - Intergenic
1195343483 X:103926580-103926602 AGAGCTAATGGGAGTGATTCTGG + Intronic
1195381732 X:104277660-104277682 GCAGGTGATGGGATGGTTTCAGG - Intergenic
1195448683 X:104984316-104984338 GGAGATAATGGGATTGCTGTGGG - Intronic
1197213854 X:123850060-123850082 GCAGGTAATCGGAATGAGTCAGG - Intergenic
1197234446 X:124043452-124043474 ACAGATAATGAAATTGATACTGG - Intronic
1197243874 X:124148355-124148377 GCAGGTAATCGGAATGAGTCAGG - Intronic
1197268776 X:124403790-124403812 GCAGGTAATCGGAATGAGTCAGG - Intronic
1197351457 X:125388118-125388140 GCAGATAAAGGGATGGTCTCTGG - Intergenic
1198178040 X:134174306-134174328 GAAGATAATGAGATTTATTTGGG - Intergenic
1198485739 X:137085798-137085820 GCAGATCATGGACTTGACTCTGG + Intergenic
1198948536 X:142042206-142042228 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1198948541 X:142042234-142042256 GCAGGTGATCGGATTGAGTCAGG + Intergenic
1200763028 Y:7057144-7057166 GCAGGTAATTGGATTGAGTCAGG + Intronic
1200763802 Y:7063488-7063510 GCAGAAAATCGGAATGAGTCAGG + Intronic
1200769465 Y:7110233-7110255 GCAGGTAATTGGAATGAGTCAGG - Intergenic
1200769470 Y:7110261-7110283 GCAGGTAATCGGAATGAGTCAGG - Intergenic
1200769475 Y:7110289-7110311 GCAGGTAATTGGATTGAGTCAGG - Intergenic
1201644639 Y:16216738-16216760 ACAGATGAAGGGATTGACTCAGG + Intergenic
1201658176 Y:16368583-16368605 ACAGATGAAGGGATTGACTCAGG - Intergenic
1201900358 Y:19041962-19041984 GCAGGTAATCGGAATGAGTCAGG + Intergenic
1201900812 Y:19044950-19044972 GCAGGTAATGGGAATGAGGCAGG - Intergenic