ID: 1024556053

View in Genome Browser
Species Human (GRCh38)
Location 7:50604495-50604517
Sequence TGGGGTCTTCAGATGGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 300}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024556053_1024556063 5 Left 1024556053 7:50604495-50604517 CCTTGCCCCATCTGAAGACCCCA 0: 1
1: 0
2: 1
3: 32
4: 300
Right 1024556063 7:50604523-50604545 CCCTGAGAACAAAGAGCTCAGGG 0: 1
1: 0
2: 1
3: 22
4: 286
1024556053_1024556061 4 Left 1024556053 7:50604495-50604517 CCTTGCCCCATCTGAAGACCCCA 0: 1
1: 0
2: 1
3: 32
4: 300
Right 1024556061 7:50604522-50604544 CCCCTGAGAACAAAGAGCTCAGG 0: 1
1: 23
2: 0
3: 25
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024556053 Original CRISPR TGGGGTCTTCAGATGGGGCA AGG (reversed) Intronic
900177799 1:1298481-1298503 TGGGGTCCTCAGGTGGGGGCAGG - Intronic
900318052 1:2069244-2069266 TGGGGCCTGCAGCTGGGGCTGGG - Intronic
901089043 1:6629424-6629446 TGGGGAGGACAGATGGGGCAGGG - Intronic
901689076 1:10960889-10960911 TGAGGTTCTCAGATGGGGGAAGG + Intronic
902657661 1:17880490-17880512 TGGAGCCTTCAGAGGGAGCATGG - Intergenic
902710739 1:18238101-18238123 TGGGTTTTTCAGTTGGGGCATGG - Intronic
902994887 1:20216632-20216654 CGGGGTCCCCAGATGGGGCAGGG + Intergenic
903544303 1:24113987-24114009 AGGGGTTTTCAAATAGGGCAGGG - Intergenic
904279286 1:29407488-29407510 TAGGGACTTCATATGGGGCCTGG + Intergenic
904448654 1:30597041-30597063 TGGGCTCTACAGAGGGGGCGAGG - Intergenic
905446341 1:38030553-38030575 TGGGGGCTTCAGTTAGGGGAGGG - Intergenic
906066772 1:42986339-42986361 TGGGGCCTTCAGTCAGGGCATGG + Intergenic
907307522 1:53521629-53521651 TGGGGTGACCAGATGGGGCTCGG - Intronic
908331124 1:63072347-63072369 GGTGGTGTTCAGGTGGGGCATGG - Intergenic
908467142 1:64407772-64407794 TGGAGGCTTCAGAGGGAGCATGG - Intergenic
908787711 1:67751545-67751567 TGGGGTCTTCAAACAGGTCAGGG + Intronic
909087020 1:71180541-71180563 TGGGATCTTCAGCTGGGTCTAGG - Intergenic
909556213 1:76957210-76957232 TGGAGCCTTCAGAGGGAGCATGG - Intronic
910978260 1:92931296-92931318 TGGGGTCTGCACATGGGGTGAGG - Intronic
911275369 1:95853058-95853080 TTGGGTCTGCATTTGGGGCAGGG - Intergenic
911551939 1:99293025-99293047 TGGGGTCATGAGAGGGGGTAGGG + Intronic
913664100 1:121031643-121031665 TGGAGTCTTCAGAGGGAGCATGG + Intergenic
914015493 1:143814922-143814944 TGGAGTCTTCAGAGGGAGCATGG + Intergenic
914162291 1:145146086-145146108 TGGAGTCTTCAGAGGGAGCATGG - Intergenic
914450634 1:147788326-147788348 AGAGGTCTCCAGATGGGTCAGGG + Intergenic
914654111 1:149723463-149723485 CGGAGTCTTCAGAGGGAGCATGG + Intergenic
915432957 1:155880823-155880845 TGGGGTCTTTACATTTGGCAAGG + Intronic
915605084 1:156945331-156945353 TGGGGTCCTCATGTGAGGCAAGG - Intronic
918039307 1:180902735-180902757 TGGGGCCTTCAGAGGAAGCATGG + Intergenic
920456845 1:206108104-206108126 TGTGGTCTAAAGATGGGGCAAGG + Intergenic
921329317 1:214019718-214019740 TGGGCTCTGCAGATGTGCCAGGG - Intronic
922092023 1:222404974-222404996 TCGGGTTTTCAGCTGGGGCGAGG + Intergenic
922094567 1:222432019-222432041 AGGAGTCTTCAGATGGGGCAGGG - Intergenic
922550263 1:226489460-226489482 CGGGGTCTTCTGATGGCCCACGG + Intergenic
924025576 1:239829630-239829652 TGTGGTCTTCAGGTTGGGGAAGG + Intronic
924671883 1:246136597-246136619 TGGGCTCTGCAGACTGGGCAGGG + Intronic
1062849101 10:729232-729254 TGGCGTCTTCAGGAAGGGCACGG - Intergenic
1062972460 10:1659689-1659711 TGGGTTGCCCAGATGGGGCAGGG - Intronic
1063087399 10:2832181-2832203 TGGGGGCTTCAGAGGGAGCATGG - Intergenic
1065699923 10:28414870-28414892 GGAGGTCTTGAGATGGGGAAGGG - Intergenic
1067789078 10:49273896-49273918 TGGAGCCTTCAGAGGGAGCACGG + Intergenic
1067816316 10:49480110-49480132 TGGTGTGCTCAGCTGGGGCAGGG - Intronic
1068286251 10:54939796-54939818 TTGTGTCCTCAGATGGTGCAAGG + Intronic
1069592533 10:69650927-69650949 GGGGGTCTCCAGATGGGGGACGG - Intergenic
1069877543 10:71572347-71572369 TGCTGTTTTCAGATGAGGCAGGG + Intronic
1070788863 10:79178008-79178030 TGGGGTCTTAGGAGGGGCCAGGG + Intronic
1070817657 10:79335513-79335535 TAGGGTCTTGAGGTGGGGCATGG + Intergenic
1074475235 10:113767763-113767785 TGGAGTCTTCAGAGAGAGCATGG - Intronic
1074524303 10:114250921-114250943 TGGGTTATACAGATGAGGCAGGG + Intronic
1075426022 10:122342290-122342312 TGGGGACTTGAGCAGGGGCAAGG + Intergenic
1075521710 10:123147550-123147572 TGAGGTCTGCAGACGGGGAAGGG + Intergenic
1075792194 10:125092954-125092976 TTGGGTCCTGAGATGGGCCATGG - Intronic
1075955656 10:126520719-126520741 TAGGGCCTTCAGAGGGAGCACGG - Intronic
1076994376 11:291004-291026 TGGGGCCTTGGGCTGGGGCAGGG - Exonic
1077106699 11:845368-845390 TGGGGCCTGTAGATGGGGCCGGG + Intronic
1077328231 11:1972821-1972843 TTGGGTCTGCAGCTGGCGCATGG - Intronic
1077914337 11:6601417-6601439 TGGGGGCCTCAGCTGGGGCCTGG + Exonic
1078607384 11:12788925-12788947 TGGGGTTTAGAGATGGGGCCTGG + Intronic
1079242399 11:18729753-18729775 TGGGGTCTTCTGGTCGGGCCAGG + Exonic
1080376844 11:31723113-31723135 TGGCATCTTGAGATGGGACATGG - Intronic
1081322497 11:41708244-41708266 TGGAGGCTTCAGAGGGAGCATGG + Intergenic
1081853638 11:46290607-46290629 TGGGGTCTGCAGGAGGGGAAGGG + Intronic
1083883461 11:65559197-65559219 GGGGGTCTTCAGGTTGGCCATGG + Intergenic
1084533000 11:69740278-69740300 TGGAGCCTTCAGAAGGAGCAGGG - Intergenic
1084915789 11:72428127-72428149 TGGGCACTGCAGATGGGGGATGG - Intronic
1085879842 11:80453730-80453752 TGGAGTCTTCAGAGGAAGCATGG - Intergenic
1086810209 11:91300567-91300589 TGAGGTATTGAGATGGGGAAGGG - Intergenic
1088702327 11:112424518-112424540 TGGAGGAATCAGATGGGGCATGG + Intergenic
1088814680 11:113412960-113412982 AGGAGTCTTCAGAGGGGGAAAGG - Intronic
1089374869 11:117986991-117987013 TGGGGGCTACAGGTGGAGCAAGG - Intronic
1090375634 11:126286863-126286885 TGGAGCCTTCAGAAGGAGCACGG - Intronic
1090755356 11:129785458-129785480 TGCTGTTTACAGATGGGGCATGG + Intergenic
1202811210 11_KI270721v1_random:28001-28023 TTGGGTCTGCAGCTGGCGCATGG - Intergenic
1093784438 12:23175987-23176009 TGGGGATTTAATATGGGGCAAGG + Intergenic
1094392903 12:29972171-29972193 TGAGGTCTTCAGAAGTGTCAAGG + Intergenic
1094616840 12:32043563-32043585 TGGAGCCTTCAGAAGGAGCATGG - Intergenic
1096220938 12:49827957-49827979 TGGGGTGAGCAGCTGGGGCAAGG + Intronic
1096253850 12:50051094-50051116 AGGGGTCTTCCTATGGGGGATGG + Intergenic
1096550836 12:52370583-52370605 TGGGGCCTTCAAAAGGTGCAGGG - Intergenic
1096868756 12:54580182-54580204 TGGGGGCTACAGAGAGGGCAGGG + Exonic
1098138131 12:67424567-67424589 TGTAGTCTTGAGATGGGACAGGG - Intergenic
1098331214 12:69355772-69355794 TGTGGTCTTCAAAAGTGGCAAGG - Intergenic
1099664304 12:85608136-85608158 TAGAGTCTTCAGAGGGAGCATGG - Intergenic
1101916559 12:108900521-108900543 TGGAGTCTTCAGAGGTGGGATGG - Exonic
1102559278 12:113750572-113750594 TGGAGACTTCAGAGGGAGCATGG - Intergenic
1102944045 12:116969828-116969850 TGGGGTGTTGAGATTTGGCAAGG + Intronic
1103166367 12:118773713-118773735 TGGAGTCTTCAGAGGGAGCGTGG + Intergenic
1103654290 12:122457832-122457854 TGGAGTCTTCAGAGGGACCAGGG + Intergenic
1103701798 12:122851915-122851937 TGGGCTCTGCAGATGGCCCAAGG - Intronic
1104552187 12:129767331-129767353 TGGGATCTTCAGCTGGGTCTAGG - Intronic
1104707908 12:130961501-130961523 TGGAGTCCTCAAATGGGCCATGG + Intronic
1104881650 12:132075503-132075525 TGTGGTCTTGAGATGGGCCCTGG + Intronic
1104925615 12:132312702-132312724 TGGGGGCTTCAGCAAGGGCAGGG - Intronic
1105347563 13:19587987-19588009 TGGGGCCTTCAGCTTAGGCACGG + Intergenic
1107812657 13:44215321-44215343 TGGAGCCTTCAGAGGGGGCATGG - Intergenic
1109711431 13:66165393-66165415 TTGGGTTTTCATAGGGGGCACGG + Intergenic
1110452787 13:75655969-75655991 TGGTGTCTCAAGATGGGACAAGG - Intronic
1112117522 13:96372982-96373004 TGGAGCCTTCAGAAGGAGCATGG - Intronic
1113168492 13:107471399-107471421 TGGGGTTTGCAGTTGGGTCAGGG + Intronic
1113890789 13:113734670-113734692 TGGGGTCTGCAGAGTGCGCAGGG + Intronic
1114557629 14:23571054-23571076 TGGGGCCCTCAGCGGGGGCAGGG + Exonic
1116288491 14:43003579-43003601 TGCTGTTTACAGATGGGGCATGG - Intergenic
1117988044 14:61407917-61407939 TGAGCTCTTCAGACAGGGCAGGG + Intronic
1119196758 14:72722901-72722923 AGGGGTCCTCGGATGGGACAAGG - Intronic
1120792508 14:88598199-88598221 TGGGTTCATGAGTTGGGGCATGG + Intronic
1121101855 14:91254819-91254841 TGGGGTCTTAAGATGGGGGCAGG - Intergenic
1121328177 14:93033938-93033960 TGGGGACTGAGGATGGGGCAGGG + Intronic
1122694343 14:103545536-103545558 TGTGGTCTTCAGAGAGGGCCTGG - Intergenic
1122801583 14:104232971-104232993 TGGGGTCTGCTGATGGGGAGGGG + Intergenic
1122830307 14:104392675-104392697 TGGGGGCTGCAGATGGGCCCCGG + Intergenic
1123837078 15:24206091-24206113 TGTGGTCTTGAGGTCGGGCACGG + Intergenic
1124681897 15:31739013-31739035 TGGGGGCTTCAGAAAGGCCACGG + Intronic
1126091061 15:45052386-45052408 TGCTGTTTACAGATGGGGCATGG + Intronic
1126672270 15:51127241-51127263 TAGAGTCTTCAGAGGGAGCACGG - Intergenic
1127045181 15:55017795-55017817 TGTGGGCATCACATGGGGCAGGG - Intergenic
1128521841 15:68380538-68380560 AGGGGTCTCCAGGTGTGGCAGGG + Intronic
1128534419 15:68479880-68479902 TGAGGTCTTAGCATGGGGCAGGG + Intergenic
1129292768 15:74581083-74581105 TGGTGTGCCCAGATGGGGCAGGG - Intronic
1129343350 15:74900626-74900648 TGGTCTCTGCAGATGGGGAAGGG + Exonic
1130078441 15:80710180-80710202 CAGGGTCCTAAGATGGGGCATGG + Intronic
1131857891 15:96618012-96618034 TAGGGTCTTCAGAGGGGACAGGG + Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132581089 16:684960-684982 TGGGGTCGGGAGGTGGGGCAGGG - Intronic
1133728432 16:8558297-8558319 TGGAGTCCTCAGAGGGTGCATGG - Intergenic
1133824151 16:9262030-9262052 TGGGGTCATCAGATGAGGGATGG - Intergenic
1134020478 16:10918087-10918109 TGTGGGCTTCACATGGAGCAGGG - Intronic
1134506737 16:14813773-14813795 TGGGGTGCTTAGGTGGGGCAGGG + Intronic
1134728599 16:16441270-16441292 TGGGGTGCTTAGGTGGGGCAGGG + Intergenic
1134938843 16:18270648-18270670 TGGGGTGCTTAGGTGGGGCAGGG - Intergenic
1135117881 16:19738999-19739021 AGGGGTCTGCAGAGGGAGCATGG - Intronic
1135284421 16:21181123-21181145 TGGGATATGCAGATGGGACAGGG + Intergenic
1135847199 16:25929507-25929529 TTTGGTCTTCACATGGGGCAAGG - Intronic
1136608247 16:31350970-31350992 TGGGGTCTCCAGAAGGGGAGAGG + Intergenic
1136709287 16:32222024-32222046 TAGGGTCTTCAGAGGGAGTATGG - Intergenic
1136758623 16:32707395-32707417 TAGGGTCTTCAGAGGGAGTATGG + Intergenic
1136809485 16:33162984-33163006 TAGGGTCTTCAGAGGGAGTATGG - Intergenic
1136815961 16:33273064-33273086 TAGGGTCTTCAGAGGGAGTATGG - Intronic
1137759572 16:50929235-50929257 TAGAGTCTTCAGACGGAGCATGG - Intergenic
1138336787 16:56259678-56259700 AGTGGTCTGCAGAAGGGGCAGGG + Intronic
1138717015 16:59035428-59035450 TAGGGCCTCCAGATGGAGCACGG - Intergenic
1139256673 16:65549504-65549526 TGGGGACTGCAAGTGGGGCAGGG - Intergenic
1140120719 16:72080991-72081013 TGGGGGTTGCAGATGGGGAAGGG - Intronic
1141441121 16:84030248-84030270 TGGAGTCTTCGGAGGGAGCATGG + Intronic
1141672654 16:85500816-85500838 TGGGGCCTTTAGAGGGAGCATGG - Intergenic
1141812878 16:86387840-86387862 TGGAGGCTTCAGAGGGAGCAGGG - Intergenic
1142005542 16:87687975-87687997 TGGGGGCCTCTGATGGGGCCAGG + Intronic
1142242512 16:88954097-88954119 TGGGGTCTTCAGAGGAGGAGTGG - Intronic
1203060777 16_KI270728v1_random:967723-967745 TAGGGTCTTCAGAGGGAGTATGG + Intergenic
1143044330 17:4064530-4064552 AGGGCTCTTCAGCTGTGGCAGGG + Exonic
1143107257 17:4535986-4536008 TGGGGGCTTCAGAAGTGCCACGG + Intronic
1143605833 17:7985097-7985119 AGGGATCCTCATATGGGGCATGG + Intergenic
1144929923 17:18850985-18851007 GGGGCTCTCCAGCTGGGGCAGGG + Intronic
1149517504 17:57291869-57291891 TGGGGTCTTCAGATGAGATCGGG - Intronic
1150684423 17:67309135-67309157 TGGAGGCTTCAGAGGGAGCATGG + Intergenic
1151813438 17:76458856-76458878 TGGGGACTTCAGCTGGGGGGTGG + Intronic
1151973973 17:77474153-77474175 TGGAGTTTTCAGATGAGGGATGG + Intronic
1152108759 17:78345435-78345457 TGGGGGCTTCAGAGGGAGCACGG + Intergenic
1152113324 17:78369581-78369603 TTGGCCCTTCAGGTGGGGCATGG + Intergenic
1152387715 17:79985086-79985108 TGGAGCCTTCAGAGGGGGCGCGG - Intronic
1152755451 17:82085209-82085231 TGGGGCCTGGAGGTGGGGCAGGG + Intronic
1154106858 18:11531074-11531096 TGGAACCTTCAGATGGGGCCAGG + Intergenic
1155549909 18:26953925-26953947 TGAAGTCTTGAAATGGGGCAAGG + Intronic
1156469294 18:37367431-37367453 TGGGTTCCTGAGCTGGGGCAGGG + Intronic
1156987343 18:43363417-43363439 TGTGGTCTTCCAATGGGTCATGG + Intergenic
1160417520 18:78721433-78721455 TGGGGGCTTCAGAAGGGGAAGGG + Intergenic
1160901227 19:1429678-1429700 TGGGGTCCTCAGGTGGAGCCGGG + Intronic
1161397458 19:4052248-4052270 TGGGGTCTGCAGAGGGGACCAGG - Intronic
1161759104 19:6157705-6157727 TGGGGGCTTAAGGTTGGGCATGG - Intronic
1161843147 19:6694401-6694423 TGGGGTCTCCAAGAGGGGCAGGG + Intronic
1161884466 19:6983174-6983196 TGGAGCCTTCAGAGGGAGCATGG - Intergenic
1162021670 19:7870895-7870917 TGGAGTCTCCAGATGGGGTGTGG + Exonic
1162461807 19:10818050-10818072 TGGGGGCTTTAGAAGGGGCTAGG - Intronic
1162781171 19:13007654-13007676 TTGTGTCCCCAGATGGGGCAAGG + Intronic
1163232634 19:16015006-16015028 AGGGGTCTGCAGCTGGGGCAAGG + Intergenic
1163691989 19:18743214-18743236 CGGGGTCTGCTGATGGGGAATGG - Intronic
1165764961 19:38344477-38344499 TGGGATCTTCATGTGGGGCCTGG - Intronic
1165783716 19:38448531-38448553 TGGGGGCTTCAGGTGAGGGAGGG - Intronic
1167599494 19:50446056-50446078 TGGGGCCTCCAGGTAGGGCACGG + Intronic
1167712678 19:51122083-51122105 TGGGGTCTTCCAAGGGGACATGG - Intergenic
1168009899 19:53521631-53521653 TGGGGTCTGCAGAGGTGGCACGG + Exonic
925132206 2:1502035-1502057 TGGGGTCCTCAGAATGGGAATGG - Intronic
925473535 2:4188353-4188375 TAGAGTCTTCAGAGGGTGCATGG - Intergenic
926142649 2:10377564-10377586 AGGGGGCTTCAGAGGTGGCAGGG - Intronic
927022807 2:19035042-19035064 TGGGTTCTTCATATGAGACAGGG + Intergenic
927186250 2:20484654-20484676 TGCGGGAATCAGATGGGGCAAGG - Intergenic
927753167 2:25687762-25687784 TTGGGTCTTGAGATGGGTTACGG - Intergenic
929745214 2:44650162-44650184 TAGGGGTTTCAGATGGAGCATGG - Intronic
929999627 2:46852235-46852257 TGGAGTCTTCAGAGGGAGCATGG - Intronic
932449007 2:71797807-71797829 TGGGGTTTTGAGATGGGTTATGG - Intergenic
933051744 2:77610283-77610305 TGAGGTGTTCAGGTGAGGCAGGG - Intergenic
933698609 2:85238310-85238332 TAGGAGCTTCAGCTGGGGCAGGG + Intronic
933780196 2:85795858-85795880 TGGGGGCTGCAGATGGGCCCTGG - Intergenic
934984228 2:98872447-98872469 TGGGGACTTCAAAAGGGGGAGGG + Intronic
935555866 2:104508856-104508878 TGTGGTCTCCAGTTGAGGCAAGG + Intergenic
937174146 2:119909883-119909905 TGGAGTCTGAAGATGGGGTAGGG + Intronic
938712335 2:133986147-133986169 TTGGGCCTTCAGAGGGAGCACGG - Intergenic
939117896 2:138081659-138081681 TGGGGTTTACAGATGGGGAAAGG + Intergenic
940528935 2:154854842-154854864 TGGGGACTTCAAATGTTGCATGG - Exonic
940856474 2:158732258-158732280 AGGGGCATTCAGAAGGGGCATGG - Intergenic
941475825 2:165951068-165951090 GGGGGTCTGGAGATGGGGTATGG - Intronic
946030893 2:216704183-216704205 TGGTGCCTTCAGAGGGAGCACGG - Intergenic
946105672 2:217367565-217367587 TGGGGCCTACAGCTGGGGAAAGG - Intronic
946173743 2:217910339-217910361 TGGGATGTTTAGATGGTGCAGGG - Intronic
946316027 2:218913157-218913179 TGGGGCCTTCAGAGGGAGCATGG + Intergenic
946982761 2:225235985-225236007 TGGGGTCTTCAGAATGAGAATGG - Intergenic
948687551 2:239678325-239678347 AGGGCCCTCCAGATGGGGCACGG + Intergenic
948781402 2:240324017-240324039 AGGGGTCTCCAACTGGGGCAAGG + Intergenic
1168786316 20:543338-543360 GGGGGTCGTCAGAGGGGGAAGGG - Intronic
1168813716 20:722624-722646 CGGGGTCTTCAGCTTGGTCATGG + Intergenic
1170420841 20:16191474-16191496 TGGAGGCTGGAGATGGGGCATGG - Intergenic
1172407802 20:34702490-34702512 TGGGGGTTTCAGATGAGGCTGGG + Intronic
1173429566 20:42974249-42974271 TGGGGAGTTCAGATGGGGAATGG - Intronic
1173801050 20:45894773-45894795 TGGAGCCTCCAGATGGGGCTGGG - Intronic
1174435784 20:50505790-50505812 TGGAGCCTTCAGAGGGAGCACGG + Intergenic
1174727543 20:52878603-52878625 TAGAGTCTTCAGAGGGAGCATGG - Intergenic
1175374930 20:58517611-58517633 TGGGGTCCTCAGATTTGGAAAGG - Intergenic
1175505853 20:59483669-59483691 TGCCGTCCTCTGATGGGGCAGGG + Intergenic
1175600067 20:60266025-60266047 TGTGTTTTTCAGATGAGGCAAGG - Intergenic
1175996126 20:62813067-62813089 TGGGGTGCCCCGATGGGGCAGGG - Exonic
1176125082 20:63471663-63471685 TGGGTTCCTGAGATGGGGGAGGG - Intronic
1176190274 20:63805596-63805618 TGGAGTCTCCAGAGGGAGCATGG + Intronic
1176364277 21:6023207-6023229 TGGGCTTTTCAGATTGGGCAGGG + Intergenic
1179465302 21:41567862-41567884 TGGGGCTTGCAAATGGGGCAGGG - Intergenic
1179640840 21:42746387-42746409 TGGGGCCTTCAGAGGTGGCAGGG - Intronic
1179759241 21:43515338-43515360 TGGGCTTTTCAGATTGGGCAGGG - Intergenic
1182556981 22:31134423-31134445 TGGGGTAGGCAGATGGGCCAAGG + Exonic
1182782039 22:32875785-32875807 TGGAGCCTTCAGAAGGAGCATGG + Intronic
1184244721 22:43230251-43230273 AGGGGAGTTCAGATGGGGCTGGG - Intronic
1184367021 22:44058225-44058247 TGGAGACTTTAGATGGAGCAAGG - Intronic
1184479897 22:44740281-44740303 TAGGGTCAGCAGATGGGGCCAGG - Intronic
1184568271 22:45306510-45306532 AGGGGTCCTGAGCTGGGGCACGG + Intergenic
1185294208 22:50045434-50045456 TGGGGACTGGAGATGGGGCCAGG + Intronic
949477946 3:4466800-4466822 TGGAGTCTTCCGGTGAGGCACGG + Intronic
949974962 3:9447973-9447995 TGGGGTATTTAGATGCAGCACGG - Exonic
954704792 3:52473675-52473697 TGGGGACTTCTGACGGAGCAAGG + Intronic
954796527 3:53164055-53164077 GGGGGTCTCCAGCTGGGGGAGGG + Intronic
956228385 3:66985542-66985564 TGGGGTATTTGGGTGGGGCAGGG - Intergenic
956669509 3:71673047-71673069 AGGGGTCTCCAGCTGGGTCATGG + Intergenic
959519091 3:107305710-107305732 TGGGGCCATCAGAGGGAGCAAGG - Intergenic
960084902 3:113580029-113580051 TGGGGACTCCACATGGGGCTTGG + Intronic
960626240 3:119685069-119685091 TGGGGTTTTCAGAAAGGGAAGGG - Intergenic
960765670 3:121127408-121127430 TAGAGTCTTCAGAGGGAGCACGG - Intronic
961203395 3:125061975-125061997 TGGAGCCTTCAGAGGGAGCATGG - Intergenic
963290302 3:143480567-143480589 TGAGGTCTCCAGATGGGATAGGG - Intronic
963678521 3:148345419-148345441 TTGTGTCCTCACATGGGGCAAGG - Intergenic
965044418 3:163557352-163557374 TAGTGTCTTCAGATGGAGCATGG - Intergenic
966914481 3:184577338-184577360 TGGGCACTTCAGACGGGGCTGGG - Exonic
969202858 4:5619506-5619528 TGGTGCCTTCAGAGGGAGCATGG + Intronic
969250894 4:5968054-5968076 TGGGTGTTTCTGATGGGGCAGGG + Intronic
969612448 4:8235065-8235087 TGGGGTCCTGAGCTGTGGCAGGG + Intronic
969855406 4:9995146-9995168 TGGGGTCTGTAGATGGGGAATGG - Intronic
970523471 4:16908567-16908589 TAGAGCCTTCAGAGGGGGCATGG + Intergenic
970985939 4:22158249-22158271 TGGGGTGTTGGGATGGGGGAGGG - Intergenic
974383047 4:61167112-61167134 TGGAGCCTTCAGAGGGAGCATGG + Intergenic
975202701 4:71609904-71609926 TGGTGTGCCCAGATGGGGCATGG + Intergenic
976626595 4:87190830-87190852 TTGTGTCTTCAGATGGTGGAAGG + Intronic
982449200 4:155531936-155531958 TGGAGGCTTCAGAGGGAGCATGG + Intergenic
985921996 5:2984575-2984597 TGGAGTCTTCAGAGGGACCATGG - Intergenic
986293680 5:6420187-6420209 TGGCATCTTCAGAGGGAGCATGG - Intergenic
987578917 5:19763098-19763120 TGGGGTCTGGGGATGGGGGAGGG + Intronic
990779088 5:59337811-59337833 TGGGGTATTCTGAATGGGCATGG + Intronic
993130803 5:83896011-83896033 TGGGGTGTTCTGATTGGGTAAGG - Intergenic
994446421 5:99879831-99879853 TGAAGTGTTCAGGTGGGGCAGGG - Intergenic
996974070 5:129409262-129409284 TGGGGCCCTCTGATGGGGCCAGG - Intergenic
998070548 5:139194661-139194683 TGGGGGCTCCAGATGGTGCTTGG - Intronic
1000393319 5:160747651-160747673 TAGAGGCTTCAGAGGGGGCATGG + Intronic
1000491414 5:161918865-161918887 TGGGGACTCCAGAGGGGGAAGGG + Intergenic
1001432846 5:171676954-171676976 TAGAGTCTTCAGAGAGGGCATGG - Intergenic
1002655442 5:180743037-180743059 GGGGATCATCAGATGGTGCAAGG - Intergenic
1004299763 6:14446616-14446638 TGGTGCCTTCAGAGGGAGCATGG - Intergenic
1004475540 6:15967891-15967913 TGGAGTCTTCAGAGGGAGCATGG - Intergenic
1004567170 6:16808679-16808701 TGGAGGCTTCAGAGGGAGCATGG - Intergenic
1007307064 6:40915193-40915215 TAGGGTCTTCAGAGAGAGCATGG - Intergenic
1008010862 6:46466273-46466295 TTTGGTTTTCAGATGGGGCATGG + Intronic
1014486601 6:122006888-122006910 AGGTGTGTTCAGATGGGGAAAGG + Intergenic
1015234347 6:130953517-130953539 TGGGGTGCGCAGATGGGGGAGGG + Intronic
1015949957 6:138542269-138542291 TGGAGCCTTCAGAGGGAGCACGG + Intronic
1016384109 6:143514279-143514301 TGTGGTGTTCACATGGGGAAAGG - Intergenic
1017061352 6:150488050-150488072 TAGGGCCTTCAGAGGGGACATGG - Intergenic
1019706383 7:2499060-2499082 TCTGTGCTTCAGATGGGGCAGGG - Intergenic
1019853769 7:3584482-3584504 AGGGGACTTCAGGTGGGGCCAGG - Intronic
1021479889 7:21104450-21104472 GGGGGTCTCCAGGTGAGGCATGG - Intergenic
1022692015 7:32665423-32665445 TGGGGAAGACAGATGGGGCAAGG + Intergenic
1022919684 7:34999976-34999998 TGGGGAAGACAGATGGGGCAAGG + Intronic
1024556053 7:50604495-50604517 TGGGGTCTTCAGATGGGGCAAGG - Intronic
1029174876 7:98657609-98657631 TGGGGCCTTCAGAGGGAGCGCGG + Intergenic
1029550346 7:101234118-101234140 TGGGGAGTACAGATGAGGCAGGG + Intronic
1031880127 7:127188442-127188464 TGAGTGCTCCAGATGGGGCATGG - Intronic
1032027643 7:128456139-128456161 TGGGGACCCCAGATGGGGCGTGG - Intronic
1032074723 7:128831027-128831049 TAGGGTCGTCCCATGGGGCAGGG + Intronic
1032285863 7:130538075-130538097 TGGTGTCATCAGTGGGGGCAGGG + Intronic
1032385162 7:131517613-131517635 TGGTGTCTTCGGAGGGAGCATGG - Intronic
1033220782 7:139525070-139525092 TGGAGTACTGAGATGGGGCAGGG + Intronic
1033235760 7:139636670-139636692 TGGAGCCTTCAGAGGGAGCATGG + Intronic
1033261861 7:139850888-139850910 TCGTGTCTTCAGAGGGAGCATGG + Intronic
1033473034 7:141665919-141665941 TGGGGCCACCAGATGGGGGACGG - Intronic
1034203903 7:149299373-149299395 TGGAGTCTTCAGAGGGAGCACGG + Intergenic
1034437340 7:151069463-151069485 GGGGGTCTTCAGATGGCTCCAGG + Intronic
1035742150 8:1936552-1936574 AAGTGTCTTCAGTTGGGGCAAGG + Intronic
1037758452 8:21726515-21726537 TGGAGCCTTCAGAGGAGGCAAGG - Intronic
1038372426 8:27007464-27007486 TGGAGACTGCAGATGGGCCAGGG + Intergenic
1043865048 8:85365033-85365055 GTGGGTGGTCAGATGGGGCAGGG + Intronic
1045035473 8:98173384-98173406 TGGGGGCTTCTGATGGTACAGGG - Intergenic
1048196988 8:132339514-132339536 TGGATCCTTAAGATGGGGCAGGG + Intronic
1049343226 8:142124861-142124883 TGGGAGCTTCAGAGGGAGCAAGG + Intergenic
1050523837 9:6528447-6528469 ATGGGTTTTCAGATGGGGCCAGG + Intergenic
1055820428 9:80255023-80255045 TAGGGCCTCCAGATGGAGCATGG + Intergenic
1056556899 9:87697179-87697201 TGGGTTCTTCAACTGGGACAAGG - Exonic
1057911128 9:99021341-99021363 AGTGGACTTCAGATGGAGCAGGG + Intronic
1059392740 9:114009159-114009181 TGGGTAATTCAGATGGGGCTTGG + Intronic
1059453275 9:114383993-114384015 TGGGCTCTTCACATGTGGTAGGG - Intronic
1059591561 9:115668242-115668264 TGGGGTCTGCTCATGGTGCAGGG - Intergenic
1059755021 9:117284548-117284570 TGGTGCCTTCAGAAGGTGCATGG + Intronic
1060213964 9:121727174-121727196 AGGGATCTCCAGATGGGGAATGG - Intronic
1062533128 9:137010444-137010466 TGGGCTCTGGAGGTGGGGCAGGG - Intronic
1185831553 X:3307881-3307903 CAGGCTCTTCAGATGGTGCAGGG - Intergenic
1186525587 X:10245100-10245122 TGTGGTTTTCAGATTGGGAATGG - Intergenic
1187503234 X:19857380-19857402 TGGGAACTTGAGATGAGGCAGGG + Intronic
1187843371 X:23511166-23511188 TGGTGTCTTCATATGGGGAGTGG - Intergenic
1189078493 X:37943378-37943400 TGAGGTCTTGAAATGGGGGAAGG + Intronic
1189773390 X:44448321-44448343 TAGAGACTTCAGATGGGGGATGG - Intergenic
1190112825 X:47605826-47605848 TGGGGTCTGCAGTTGGGATAGGG - Intronic
1190379942 X:49829606-49829628 TGGGGTCCTCAGTGGGGGCCAGG + Intronic
1191667770 X:63720971-63720993 TGCTGTCTTTAGATGGGGCATGG + Intronic
1194979757 X:100428309-100428331 TAGAGTCTTCAGAGGGAGCATGG - Intergenic
1195062432 X:101209491-101209513 GGGGGTCTCCTGCTGGGGCAAGG - Intergenic
1197324994 X:125081976-125081998 TGGGGACTCCAAAAGGGGCAAGG + Intergenic
1197986371 X:132270165-132270187 TGGGATGTTCAGAGGGAGCAGGG - Intergenic
1199361470 X:146924420-146924442 TGGGGACTTCAGAAGGAGGAGGG - Intergenic
1199464079 X:148116353-148116375 TGGGGTCTTCTCATGGGGGTGGG - Intergenic
1200064573 X:153498289-153498311 TGAGGTGTTCAGATGGGCCAAGG + Intronic
1200082485 X:153585069-153585091 TGGAGCCTTCAGAGGGAGCATGG - Intergenic
1200907698 Y:8501481-8501503 TGGGGTGGGCAGATGGGGGAGGG - Intergenic
1201245035 Y:11995127-11995149 CTGGTTCTTCAGATGGTGCAGGG + Intergenic