ID: 1024559536

View in Genome Browser
Species Human (GRCh38)
Location 7:50631695-50631717
Sequence TAGGGTAGGTCACCCAGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 81}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024559536_1024559542 -3 Left 1024559536 7:50631695-50631717 CCTGTTCTGGGTGACCTACCCTA 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1024559542 7:50631715-50631737 CTACCCTACCTGGCCTCCGAGGG 0: 1
1: 0
2: 1
3: 17
4: 187
1024559536_1024559541 -4 Left 1024559536 7:50631695-50631717 CCTGTTCTGGGTGACCTACCCTA 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1024559541 7:50631714-50631736 CCTACCCTACCTGGCCTCCGAGG 0: 1
1: 0
2: 1
3: 12
4: 256
1024559536_1024559543 -2 Left 1024559536 7:50631695-50631717 CCTGTTCTGGGTGACCTACCCTA 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1024559543 7:50631716-50631738 TACCCTACCTGGCCTCCGAGGGG 0: 1
1: 0
2: 0
3: 7
4: 94
1024559536_1024559547 6 Left 1024559536 7:50631695-50631717 CCTGTTCTGGGTGACCTACCCTA 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1024559547 7:50631724-50631746 CTGGCCTCCGAGGGGCCTTGAGG 0: 1
1: 0
2: 4
3: 24
4: 206
1024559536_1024559550 16 Left 1024559536 7:50631695-50631717 CCTGTTCTGGGTGACCTACCCTA 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1024559550 7:50631734-50631756 AGGGGCCTTGAGGAGAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024559536 Original CRISPR TAGGGTAGGTCACCCAGAAC AGG (reversed) Intronic
901056311 1:6450141-6450163 TGGGGTAGGGCACCCAGCCCTGG - Intronic
902478038 1:16698349-16698371 TGGGGTAGGGCACCCAGCCCTGG + Intergenic
907096053 1:51782055-51782077 AAGAGTAGGTAACCCAGAACTGG + Intronic
907364922 1:53950163-53950185 TAGGGAAGGTTTCCCAGAAGAGG + Intronic
908640006 1:66212178-66212200 TAGGGGAGGTCACCTAGAGTTGG - Intronic
910333568 1:86103771-86103793 AAGGTCAGGTCACCCAGAAAGGG - Intronic
914785133 1:150822543-150822565 GAGGGTAGCCCACCCAGAAAGGG + Intronic
916364842 1:164014451-164014473 TAGGGTAAGTAATTCAGAACAGG + Intergenic
917585541 1:176423592-176423614 AAGGGCAGGTCACCCACAAAGGG - Intergenic
919941405 1:202289003-202289025 TAAGATATGGCACCCAGAACAGG - Intronic
923463315 1:234226322-234226344 TAGGGTAAGGGACCCAGAGCGGG - Intronic
1064741742 10:18441174-18441196 GAGGGTAGATCACCCAGGTCAGG + Intronic
1068284238 10:54913692-54913714 CAGGGTAGATCACCCACAGCTGG - Intronic
1069847717 10:71384337-71384359 TTGGGGAGGTGACCCAGAGCTGG + Intergenic
1070537094 10:77387423-77387445 TAGGGAATGTGACCTAGAACAGG + Intronic
1070850550 10:79559032-79559054 TAGGATCTGTCACCCACAACTGG + Intronic
1070856666 10:79612263-79612285 TAGGATCTGTCACCCACAACTGG - Intronic
1077304443 11:1862823-1862845 GAGGGGAGGTCACCCAGAGGAGG - Intronic
1077402980 11:2368123-2368145 TAGGGTAGCTCAGCCAGCTCTGG + Intergenic
1078879743 11:15436479-15436501 TGGAGTAGGACACCCAGGACTGG + Intergenic
1078902236 11:15652098-15652120 TAGGGCAGGATACCCAGACCTGG + Intergenic
1089255197 11:117190405-117190427 TAGGGTGGGCCAGACAGAACTGG - Intronic
1089844693 11:121449431-121449453 CAGGCAAGGTCACCCAGGACAGG - Intergenic
1094265983 12:28560340-28560362 TGGGGTAAGTCACCGAGAACTGG + Intronic
1104677420 12:130722007-130722029 AAGGGCAGGTCACCCACAAAGGG + Intergenic
1113481825 13:110626807-110626829 TAGGAGAGGTCACACCGAACAGG + Intronic
1118257587 14:64218613-64218635 TAGGGTAAGTCCCCCAGTTCTGG - Intronic
1122807280 14:104266251-104266273 GGGGGCAGGTCTCCCAGAACAGG - Intergenic
1122952696 14:105054366-105054388 TGGGGCAAGTCACCCCGAACGGG + Intronic
1131695600 15:94874658-94874680 TAGGGAAGGTCTCTCAGAAAAGG - Intergenic
1137626290 16:49910846-49910868 GAGGGGAGGCCACCCAGAATGGG + Intergenic
1146285732 17:31573039-31573061 CAAGGAAGGTCACCCAGAAGAGG + Intronic
1146442518 17:32909777-32909799 TAGGGAAAGTCACCCAAGACTGG - Intergenic
1153785548 18:8530793-8530815 AAGGGTAGGTCACCTACAAAGGG + Intergenic
1164067705 19:21734810-21734832 AAGGCCAGGTCACCCAGAAAGGG + Intronic
1167491258 19:49793716-49793738 TAGGATAGGTCACCCATAGGAGG + Intronic
1202712058 1_KI270714v1_random:24176-24198 TGGGGTAGGGCACCCAGCCCTGG + Intergenic
926304715 2:11629619-11629641 TTGAGTTGGTGACCCAGAACAGG + Intronic
926526556 2:13988691-13988713 TAGTGTAGTTTACACAGAACAGG + Intergenic
932549030 2:72747802-72747824 TAGGGAAGGTTTCCCAGAAAAGG - Intronic
934811118 2:97277514-97277536 AAGGGCAGGTCACCTACAACGGG + Intergenic
934826574 2:97430425-97430447 AAGGGCAGGTCACCTACAACGGG - Intergenic
935392055 2:102563161-102563183 TAGGGTAGGGCAGGCAGAAATGG - Intergenic
938900751 2:135796882-135796904 TAGGGTAAGTTCCCCAGAGCAGG - Intronic
942090328 2:172483672-172483694 TAGTGTAGGTTATCAAGAACAGG + Intronic
942468239 2:176231399-176231421 TAGGGTGGCTCACCAAGAACGGG - Intergenic
945244095 2:207702425-207702447 TGGGGAAGGGCACCCAGACCTGG + Intergenic
948302366 2:236917336-236917358 AAGGGTAGTTCACACAGAACTGG + Intergenic
1170723071 20:18901248-18901270 GAGGGCTGGGCACCCAGAACTGG + Intergenic
1174329507 20:49806711-49806733 TAGGGCTGGTGACTCAGAACAGG + Intergenic
1182049380 22:27301258-27301280 TAGGGTAAGTCAGCCAGCCCTGG - Intergenic
1184003785 22:41694272-41694294 CAGGGTGGGACACCCAGGACCGG + Exonic
949167124 3:956286-956308 AAGGATAGGTCTCTCAGAACTGG - Intergenic
954887999 3:53893469-53893491 CAGGGAAGGGCACCCAGAAGTGG - Intergenic
954900318 3:54013707-54013729 TAAGGTAAGTTACTCAGAACAGG + Intergenic
955343778 3:58145931-58145953 TGGGGTAGTTCACGTAGAACTGG - Exonic
961340774 3:126216030-126216052 CAGCGTAGGTCACCCAGCACTGG - Intergenic
966882497 3:184358239-184358261 CAGGGTAGGTGACCCAGGCCAGG + Exonic
966908120 3:184542468-184542490 TAGGGTAGGGCAGCCTGAGCAGG + Intronic
981581866 4:146257507-146257529 TAGGGTAGTTCAGCCAGTGCTGG - Intronic
981606238 4:146544230-146544252 AAGGGTAGGTCACCTACAAAGGG - Intergenic
982378338 4:154719861-154719883 TATGCTAGGTCAGCCAAAACAGG + Intronic
983682775 4:170372732-170372754 TAAGGTAGGTCACTCAGAGGAGG - Intergenic
986820912 5:11465907-11465929 TAGGAAAGGTTATCCAGAACTGG - Intronic
987179829 5:15355998-15356020 TAGGGTAGGTCATTCAGAGCAGG + Intergenic
989441827 5:41481371-41481393 TAAGCTAGATCTCCCAGAACTGG + Intronic
992228525 5:74641224-74641246 TTGGGTAGGACACCCAGAGTGGG + Exonic
993114520 5:83704002-83704024 AAGGGCAGGTCACCTAGAAAAGG + Intronic
995054187 5:107741258-107741280 TAGGGTATATCACCAAGATCAGG + Intergenic
996488016 5:124059380-124059402 TAGGGCAGGTGACTCAGACCTGG - Intergenic
996843500 5:127874362-127874384 TTTGGGAGGTCACCCAGATCAGG - Intergenic
999018329 5:148133999-148134021 TAGGTCAGGTGACCCAGAATTGG + Intronic
999318054 5:150596755-150596777 AAGGGTAGGGGACCCAGAAGAGG + Intergenic
1001465590 5:171962400-171962422 TAGGGTTGTTCACAGAGAACAGG + Intronic
1004218449 6:13724127-13724149 TAGGTTAGGTGTCCCAGATCAGG + Intergenic
1006722613 6:36167765-36167787 GAGGGCATGTAACCCAGAACTGG + Intergenic
1020940109 7:14522573-14522595 TATGGTAGTTCAACCAGGACAGG - Intronic
1021327820 7:19296449-19296471 TAGGGTAGGACATTGAGAACGGG + Intergenic
1024559536 7:50631695-50631717 TAGGGTAGGTCACCCAGAACAGG - Intronic
1033550721 7:142445244-142445266 GAGGGCAGGTGACCCAGAAGAGG + Intergenic
1044243612 8:89915361-89915383 GAGGGTAGGTCCCTCAGAATGGG - Intronic
1045018340 8:98018916-98018938 TTCTATAGGTCACCCAGAACAGG + Intronic
1048174369 8:132138588-132138610 TAAAGTGGGGCACCCAGAACTGG + Intronic
1052648060 9:31263487-31263509 AAAATTAGGTCACCCAGAACAGG + Intergenic
1061709907 9:132480381-132480403 TGGGGCAGGTCTTCCAGAACAGG - Intronic
1187614990 X:20983217-20983239 TTGGGTAGGTCACCTACAAAGGG + Intergenic
1190600469 X:52087591-52087613 AAGGCTAGGTCACCCACAAAGGG - Intergenic
1198480394 X:137034861-137034883 TAGGGAAGGTGACCCAGACCAGG + Intergenic
1199655859 X:149994872-149994894 TAGGCTAGTTCAGTCAGAACTGG + Intergenic