ID: 1024559916

View in Genome Browser
Species Human (GRCh38)
Location 7:50634619-50634641
Sequence TCTTGTAGGCAGCAGATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2042
Summary {0: 1, 1: 3, 2: 86, 3: 497, 4: 1455}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024559916_1024559923 22 Left 1024559916 7:50634619-50634641 CCAGCCATCTGCTGCCTACAAGA 0: 1
1: 3
2: 86
3: 497
4: 1455
Right 1024559923 7:50634664-50634686 ACCTACAGACTCAAAGTAAATGG No data
1024559916_1024559919 -9 Left 1024559916 7:50634619-50634641 CCAGCCATCTGCTGCCTACAAGA 0: 1
1: 3
2: 86
3: 497
4: 1455
Right 1024559919 7:50634633-50634655 CCTACAAGAGACCCACCTAACGG 0: 3
1: 4
2: 15
3: 19
4: 81
1024559916_1024559926 26 Left 1024559916 7:50634619-50634641 CCAGCCATCTGCTGCCTACAAGA 0: 1
1: 3
2: 86
3: 497
4: 1455
Right 1024559926 7:50634668-50634690 ACAGACTCAAAGTAAATGGGTGG No data
1024559916_1024559925 23 Left 1024559916 7:50634619-50634641 CCAGCCATCTGCTGCCTACAAGA 0: 1
1: 3
2: 86
3: 497
4: 1455
Right 1024559925 7:50634665-50634687 CCTACAGACTCAAAGTAAATGGG 0: 1
1: 1
2: 8
3: 63
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024559916 Original CRISPR TCTTGTAGGCAGCAGATGGC TGG (reversed) Intronic
Too many off-targets to display for this crispr