ID: 1024560423

View in Genome Browser
Species Human (GRCh38)
Location 7:50640255-50640277
Sequence GATGCTGGAGATCCCCAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024560419_1024560423 6 Left 1024560419 7:50640226-50640248 CCTTGTTGGGTATGGTTTTTGGC 0: 1
1: 0
2: 0
3: 11
4: 94
Right 1024560423 7:50640255-50640277 GATGCTGGAGATCCCCAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024560423 Original CRISPR GATGCTGGAGATCCCCAAAT GGG Intronic
No off target data available for this crispr