ID: 1024563490

View in Genome Browser
Species Human (GRCh38)
Location 7:50663421-50663443
Sequence TGGTGAGAGGCTGTGGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6902
Summary {0: 1, 1: 1, 2: 28, 3: 438, 4: 6434}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024563490_1024563495 -4 Left 1024563490 7:50663421-50663443 CCTCCTGCCACAGCCTCTCACCA 0: 1
1: 1
2: 28
3: 438
4: 6434
Right 1024563495 7:50663440-50663462 ACCATCGAGTCCCTCCACTTGGG 0: 1
1: 0
2: 0
3: 3
4: 84
1024563490_1024563501 17 Left 1024563490 7:50663421-50663443 CCTCCTGCCACAGCCTCTCACCA 0: 1
1: 1
2: 28
3: 438
4: 6434
Right 1024563501 7:50663461-50663483 GGATGAGTGCCATGTGACTAGGG No data
1024563490_1024563503 30 Left 1024563490 7:50663421-50663443 CCTCCTGCCACAGCCTCTCACCA 0: 1
1: 1
2: 28
3: 438
4: 6434
Right 1024563503 7:50663474-50663496 GTGACTAGGGTCCTTCTCACAGG No data
1024563490_1024563500 16 Left 1024563490 7:50663421-50663443 CCTCCTGCCACAGCCTCTCACCA 0: 1
1: 1
2: 28
3: 438
4: 6434
Right 1024563500 7:50663460-50663482 GGGATGAGTGCCATGTGACTAGG 0: 1
1: 0
2: 1
3: 11
4: 134
1024563490_1024563494 -5 Left 1024563490 7:50663421-50663443 CCTCCTGCCACAGCCTCTCACCA 0: 1
1: 1
2: 28
3: 438
4: 6434
Right 1024563494 7:50663439-50663461 CACCATCGAGTCCCTCCACTTGG 0: 1
1: 0
2: 1
3: 7
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024563490 Original CRISPR TGGTGAGAGGCTGTGGCAGG AGG (reversed) Intronic
Too many off-targets to display for this crispr