ID: 1024563491

View in Genome Browser
Species Human (GRCh38)
Location 7:50663424-50663446
Sequence CGATGGTGAGAGGCTGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 381}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024563491_1024563503 27 Left 1024563491 7:50663424-50663446 CCTGCCACAGCCTCTCACCATCG 0: 1
1: 0
2: 1
3: 36
4: 381
Right 1024563503 7:50663474-50663496 GTGACTAGGGTCCTTCTCACAGG No data
1024563491_1024563504 28 Left 1024563491 7:50663424-50663446 CCTGCCACAGCCTCTCACCATCG 0: 1
1: 0
2: 1
3: 36
4: 381
Right 1024563504 7:50663475-50663497 TGACTAGGGTCCTTCTCACAGGG 0: 1
1: 0
2: 2
3: 22
4: 218
1024563491_1024563494 -8 Left 1024563491 7:50663424-50663446 CCTGCCACAGCCTCTCACCATCG 0: 1
1: 0
2: 1
3: 36
4: 381
Right 1024563494 7:50663439-50663461 CACCATCGAGTCCCTCCACTTGG 0: 1
1: 0
2: 1
3: 7
4: 153
1024563491_1024563495 -7 Left 1024563491 7:50663424-50663446 CCTGCCACAGCCTCTCACCATCG 0: 1
1: 0
2: 1
3: 36
4: 381
Right 1024563495 7:50663440-50663462 ACCATCGAGTCCCTCCACTTGGG 0: 1
1: 0
2: 0
3: 3
4: 84
1024563491_1024563501 14 Left 1024563491 7:50663424-50663446 CCTGCCACAGCCTCTCACCATCG 0: 1
1: 0
2: 1
3: 36
4: 381
Right 1024563501 7:50663461-50663483 GGATGAGTGCCATGTGACTAGGG No data
1024563491_1024563500 13 Left 1024563491 7:50663424-50663446 CCTGCCACAGCCTCTCACCATCG 0: 1
1: 0
2: 1
3: 36
4: 381
Right 1024563500 7:50663460-50663482 GGGATGAGTGCCATGTGACTAGG 0: 1
1: 0
2: 1
3: 11
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024563491 Original CRISPR CGATGGTGAGAGGCTGTGGC AGG (reversed) Intronic
900417493 1:2541858-2541880 CGATCGTGGGAGGCTCTGCCTGG - Intergenic
900503664 1:3018630-3018652 CAAGGGTAAGAGGCTGTGCCCGG + Intergenic
900517057 1:3087296-3087318 TGAAGGTGAGAGGCCCTGGCTGG - Intronic
900691798 1:3985231-3985253 GGATGGGAAGAGGCTGGGGCAGG - Intergenic
900943363 1:5815436-5815458 CGATGGTCAGCTGCTGAGGCAGG - Intergenic
901099520 1:6708614-6708636 TTATGGTGGGAGGCTGAGGCAGG - Intergenic
902373604 1:16019757-16019779 AGATGGAGAGAGGGTGGGGCGGG + Intronic
902609789 1:17590213-17590235 CCCTGATGAGAGGGTGTGGCTGG + Intronic
902744578 1:18464966-18464988 CCATGGGGAGAGGCAGTGGCCGG + Intergenic
902926540 1:19699663-19699685 GCATGGTGGGAGGCTGAGGCAGG - Intronic
902935820 1:19763869-19763891 CGATTTTGAGAGGCTGAGCCTGG + Intronic
903143187 1:21352304-21352326 AGATGGGGAGAGGCTGGAGCAGG + Intergenic
903324829 1:22563725-22563747 CGAAGGTGAGCGGCGGCGGCGGG + Exonic
903368482 1:22819293-22819315 AGGTTGTGAGAGGCGGTGGCCGG - Intronic
903493252 1:23745024-23745046 TGATGGTGAGAGGCTGTGTACGG - Intronic
904483234 1:30807171-30807193 GGCTGGTGAGAGGCTGGGTCGGG + Intergenic
904773470 1:32893625-32893647 CGACGGTGAGGGGCAGGGGCGGG + Exonic
905205603 1:36341278-36341300 GGACGGAAAGAGGCTGTGGCAGG + Exonic
906826651 1:48988620-48988642 CAATACTGAGAGCCTGTGGCTGG + Intronic
907291763 1:53418475-53418497 CTGTGGTGGGAGGCTGAGGCAGG + Intergenic
908220361 1:61999990-62000012 GGAGGCTGAGAGGCTGAGGCAGG - Intronic
908825413 1:68128206-68128228 GGCTGGTGAGAGGCTTTAGCTGG + Intronic
911950164 1:104163262-104163284 TGATAGTGGGAGGCTGTGGGGGG + Intergenic
912284754 1:108357325-108357347 CCAAGGTGAGTGGCTGTGGTAGG - Intergenic
915069243 1:153252445-153252467 GGATGGTCAGAGGCAGTGACAGG - Intergenic
915180735 1:154057222-154057244 GCATGATGGGAGGCTGTGGCAGG - Intronic
916266046 1:162890830-162890852 GGAGGCTGAGAGGCTGAGGCAGG - Intergenic
916526722 1:165617479-165617501 CCATGTTTAGAGGCTGGGGCTGG - Intergenic
917389332 1:174516813-174516835 TGATGTTGGGAGGCTGAGGCAGG + Intronic
918308458 1:183268071-183268093 GGATGGGGAGAGGATGTGGGAGG + Intronic
919660215 1:200236798-200236820 GGATGGTGAGAAGCTGGGGTGGG - Intergenic
920269076 1:204749839-204749861 AGATGGTGAGGTGCTGTAGCAGG + Intergenic
921300058 1:213743649-213743671 TGTAGATGAGAGGCTGTGGCAGG - Intergenic
921300766 1:213749542-213749564 TGTAGATGAGAGGCTGTGGCAGG + Intergenic
921675304 1:217969290-217969312 GCATGGTGAGAGGTGGTGGCAGG - Intergenic
922038686 1:221874718-221874740 GGATGGTAAGTGGCAGTGGCAGG - Intergenic
922507204 1:226133484-226133506 CTATGGTGAGAAGCTGTGTGAGG + Intergenic
924940264 1:248808476-248808498 TGTTGGTGAGAGCCTGTGTCAGG + Intergenic
1062951695 10:1508306-1508328 CTATGGTCAGAGGCTGCGTCTGG + Intronic
1063019489 10:2113617-2113639 GCATGTTGAGAGGCTGAGGCAGG - Intergenic
1063452038 10:6156618-6156640 TGGTGGTGGGAGGCTGAGGCAGG - Intronic
1063517988 10:6715133-6715155 CAAGGCTGAGAGGCTGAGGCGGG - Intergenic
1064037058 10:11922923-11922945 AGATACTGAGAGGCTGAGGCAGG + Intronic
1064821966 10:19346894-19346916 GCATGTTGAGAGGCTGAGGCAGG - Intronic
1064828896 10:19439423-19439445 TGATGGTGGGAGGCTGAGGCAGG + Intronic
1067145227 10:43689389-43689411 CGAGGGTGAGGGGCTGAGCCGGG + Intergenic
1067509339 10:46882408-46882430 CTGTGGTGAGAGGCAGAGGCAGG + Intergenic
1067652914 10:48169447-48169469 CTGTGGTGAGAGGCAGAGGCAGG - Intronic
1069434082 10:68364804-68364826 AGATGCTGAGAGGCTGAGGTGGG - Intronic
1069669233 10:70187861-70187883 CAATTGTGGGAGGCTGAGGCAGG - Intergenic
1069711650 10:70493229-70493251 ACATTTTGAGAGGCTGTGGCGGG - Intronic
1069783691 10:70974481-70974503 TGATGGTAAGAGGCTGTGACAGG + Intergenic
1072118803 10:92388176-92388198 ACACGGTGAGAGGCTGAGGCAGG + Intergenic
1072370349 10:94760136-94760158 TGATTGTGAGAGGCTGTGTGTGG + Intronic
1072721317 10:97782625-97782647 CCCTGGAGGGAGGCTGTGGCCGG - Intergenic
1072974225 10:100043745-100043767 GGAGGCTGAGAGGCTGAGGCAGG - Intronic
1074086097 10:110209926-110209948 CGCTGGTGAGGGGGGGTGGCTGG - Intronic
1074474395 10:113756217-113756239 TGTTGGTGGGAGGCTGAGGCAGG + Intronic
1074489292 10:113924532-113924554 GGCTGGGGAGAGGCTGAGGCTGG + Intergenic
1076070976 10:127488912-127488934 TGTTGGTGGGAGGCTGAGGCAGG - Intergenic
1076418747 10:130312779-130312801 GGATGGTGAGAGGAAGAGGCTGG + Intergenic
1076449500 10:130546985-130547007 CGGTCGTGAGAGGCTGTGCATGG + Intergenic
1078143451 11:8707759-8707781 CCAAGGTAAGAGGCTCTGGCAGG - Exonic
1078399401 11:11010765-11010787 CGCTGCTGACAGGCTGTGGTTGG - Intergenic
1079243108 11:18734674-18734696 CAATGCAGAGAGGCTGTAGCTGG - Intronic
1081533250 11:43978929-43978951 TGATGGGGAGAGGCTGTGATTGG + Intergenic
1081727223 11:45338871-45338893 CGGTGGTGAGATGCAGAGGCAGG + Intergenic
1082259873 11:50070704-50070726 GGATAGTGAGAGGCAGTAGCTGG + Intergenic
1083776820 11:64898068-64898090 TGAGGGTGAGAGGCTGGGCCAGG - Exonic
1084625147 11:70300479-70300501 AGATACTGAGAGGCTGAGGCAGG - Intronic
1085280447 11:75326613-75326635 TGTGGGAGAGAGGCTGTGGCAGG - Intronic
1086171635 11:83842947-83842969 CCATGGTGAGAGGCTGTATTGGG + Intronic
1087754856 11:102044527-102044549 GCATGTTGGGAGGCTGTGGCAGG - Intergenic
1088921240 11:114261063-114261085 CAATGGGGACAGGCTCTGGCTGG + Intronic
1091412035 12:248288-248310 CCATGCTGGGAGGCTGAGGCAGG + Intronic
1092159842 12:6310365-6310387 CGAGGGTGACAACCTGTGGCAGG - Intergenic
1092200376 12:6578578-6578600 CGATGGTGCTGGGCTTTGGCTGG - Intronic
1092844593 12:12572309-12572331 CGAAGGTCAGAGGCAGTGTCTGG + Intergenic
1093928895 12:24935489-24935511 CGTAGGTTAGGGGCTGTGGCAGG - Intronic
1094004013 12:25727604-25727626 TGGTGGTGGGAGGCTGAGGCAGG + Intergenic
1100971359 12:100074350-100074372 GCACGGTGAGAGGCTGAGGCGGG + Intronic
1103416874 12:120748120-120748142 CGGGGGTGGGAGGCTGAGGCAGG + Intergenic
1103785675 12:123431088-123431110 CTGTGGTGAGAGGCTGAGGCAGG - Intronic
1103957293 12:124584448-124584470 CTAAGGTGGGAGGCTGAGGCGGG - Intergenic
1105562081 13:21501790-21501812 CCACGCTCAGAGGCTGTGGCAGG - Intronic
1107605199 13:42049135-42049157 GGATGGTGAGACGGTGAGGCGGG + Intronic
1109630122 13:65034437-65034459 GGAGGGTGAGAGGAGGTGGCGGG - Intergenic
1110727242 13:78839580-78839602 TGATGGTCAGAGGCTGTGTTTGG + Intergenic
1113697455 13:112356082-112356104 CGATGGAGAAAGGCCGTTGCTGG - Intergenic
1115258242 14:31425504-31425526 TGGTGGTGGGAGGCTGAGGCAGG + Intronic
1118005009 14:61557859-61557881 CAATGATGAGAGGTGGTGGCTGG + Intronic
1118597673 14:67448627-67448649 GGATGGTGGGGGGCTGTGGAGGG + Intronic
1118761940 14:68885377-68885399 CTGTGGTGAGGGGCTGAGGCTGG - Intronic
1119298297 14:73551050-73551072 GGAGGTTGAGAGGCTGAGGCAGG + Intronic
1119302590 14:73583235-73583257 GGAGGTTGAGAGGCTGAGGCAGG + Intergenic
1119660207 14:76445794-76445816 CTATCTTGGGAGGCTGTGGCAGG - Intronic
1119717663 14:76870241-76870263 CGATGGACAGATGCTGTGGCAGG + Intronic
1121028391 14:90634523-90634545 GTATTGTGGGAGGCTGTGGCGGG + Intronic
1121529908 14:94644899-94644921 AGAAGGTGAGAGGCTGTTTCAGG + Intergenic
1122068352 14:99189274-99189296 CGGTGGTGTCAGGCTGTGCCTGG - Intronic
1122793776 14:104195493-104195515 GGTGGGTGAGAGGCTGTGGAGGG + Intergenic
1122885012 14:104707047-104707069 CGATGGTGAGGGGGCGGGGCAGG + Exonic
1122939271 14:104973965-104973987 GGATGGGGAGGGGCTGGGGCGGG - Intronic
1123492599 15:20794513-20794535 GGATGTTGAGAGGCTGAGGCAGG + Intergenic
1123549100 15:21363605-21363627 GGATGTTGAGAGGCTGAGGCAGG + Intergenic
1124961756 15:34402661-34402683 GGATGGTGGGAGGCTGAGGCAGG - Intronic
1124978381 15:34548883-34548905 GGATGGTGGGAGGCTGAGGCAGG - Intronic
1126536460 15:49770847-49770869 CCATGCTGGGAGGCTGAGGCAGG - Intergenic
1127555335 15:60082049-60082071 CAATAGAGAGAGGCTGTGGGAGG + Intergenic
1127734304 15:61827738-61827760 CTATGGGCAGAGGCTGTCGCTGG + Intergenic
1128213767 15:65920213-65920235 CCATGGTTAGTAGCTGTGGCAGG + Intronic
1128308821 15:66617822-66617844 CTGTGGTGAGAGGCTGAGGTGGG - Intronic
1128915051 15:71552159-71552181 CCATTGTGAGGGGATGTGGCGGG + Intronic
1129486486 15:75878485-75878507 GGGTGGTGGGAGGCTGAGGCAGG + Intronic
1129523712 15:76201184-76201206 TGATTGGGAGAGGCTGTGGCAGG - Intronic
1129562145 15:76581830-76581852 GCATGTTGGGAGGCTGTGGCTGG - Intronic
1129692424 15:77721347-77721369 AGAGGGTGGGAGGCAGTGGCTGG - Intronic
1132209651 15:100010516-100010538 TATGGGTGAGAGGCTGTGGCAGG + Intronic
1202957435 15_KI270727v1_random:90827-90849 GGATGTTGAGAGGCTGAGGCAGG + Intergenic
1132579221 16:677495-677517 CGGTGGTGGGAGGCTCCGGCGGG + Exonic
1132625442 16:889389-889411 CGTGGGTGTGAGGCTGTGGATGG + Intronic
1132859476 16:2062911-2062933 GGCTGGTGTGGGGCTGTGGCCGG + Intronic
1134492506 16:14705627-14705649 GGAGGCTGAGAGGCTGAGGCAGG - Intergenic
1134497887 16:14744749-14744771 GGAGGCTGAGAGGCTGAGGCAGG - Intronic
1134915998 16:18071569-18071591 CGATGGAGAGAGGCTGGGTAGGG - Intergenic
1135280636 16:21151430-21151452 CACTGGTGGGAGGCTGAGGCAGG - Intronic
1135538324 16:23311646-23311668 AGTTGGAGAGAGGCTTTGGCAGG + Intronic
1135909325 16:26544831-26544853 AGACGGTGAGAGGTTGTGGATGG + Intergenic
1136005851 16:27328353-27328375 GGAGGCTGAGAGGCTGAGGCAGG - Intronic
1138223931 16:55276488-55276510 CGGTGTGGAGGGGCTGTGGCGGG + Intergenic
1138347144 16:56326987-56327009 CGATGGTGAGTGGCAGGGGTGGG - Intronic
1138816122 16:60204858-60204880 GGAGGCTGAGAGGCTGAGGCAGG - Intergenic
1139339800 16:66260991-66261013 AGATGGTGTCAGGCTGCGGCTGG - Intergenic
1139494217 16:67304259-67304281 CCATGGAGAGGGCCTGTGGCAGG + Intronic
1139705297 16:68737189-68737211 CGCTGCTGATTGGCTGTGGCCGG + Intergenic
1140986211 16:80160213-80160235 AGATGGTGAGAGGATGTACCTGG + Intergenic
1141656327 16:85418577-85418599 CTATGCTGAGAGGCTGGGTCTGG - Intergenic
1142103192 16:88286424-88286446 AGATGGGGAGAGGATGGGGCAGG - Intergenic
1142253761 16:89003994-89004016 CGAGGGGGAGAGGCTGCGGTGGG + Intergenic
1142751388 17:1990253-1990275 CGAGGCTGAGAGGCTGAGGCAGG + Intronic
1142766176 17:2065450-2065472 AGCTGGTGAGACCCTGTGGCAGG - Exonic
1143143443 17:4756644-4756666 GCATGTTGGGAGGCTGTGGCAGG + Intergenic
1143146543 17:4780299-4780321 GCATGTTGAGAGGCTGAGGCTGG - Intronic
1143558095 17:7675035-7675057 CGATGGTGAGCAGCTGGGGCTGG - Exonic
1145797489 17:27664298-27664320 GGATGGGGAGAGTCTGTGGCTGG - Intergenic
1145976817 17:28988644-28988666 GGGTGGTGAGAGGCTGTGATGGG - Intronic
1146162420 17:30567076-30567098 GGATGGAGGGAGGCGGTGGCAGG - Intergenic
1146692085 17:34883521-34883543 CAATGGAGCCAGGCTGTGGCAGG + Intergenic
1147321782 17:39651053-39651075 CGATGGGGAGGGGATGTGACAGG - Intronic
1148121591 17:45215681-45215703 CCAAGGTGAGAGGCCGAGGCAGG - Intergenic
1148321768 17:46760383-46760405 CAATGCTGAGAGGCTGAGGTGGG + Intergenic
1148793676 17:50187234-50187256 CTATGGAAAGAGGCTGAGGCTGG - Intronic
1149914558 17:60597326-60597348 CTAGGGGGAGAGGCTGAGGCAGG - Intergenic
1151118677 17:71767612-71767634 GGGTGGTGGGAGGCTGAGGCAGG - Intergenic
1151189614 17:72388708-72388730 CGACTTTGGGAGGCTGTGGCAGG - Intergenic
1151759739 17:76093833-76093855 CCATGATGAGAGGCCGGGGCCGG - Intronic
1152344845 17:79745022-79745044 GCACGGTGAGAGGCTGAGGCAGG + Intergenic
1152728115 17:81957652-81957674 GGAGGGTGAGAGGCTGGAGCTGG - Intronic
1152800280 17:82327683-82327705 CGTTGGTGAGGGGCTGGGGCTGG - Intronic
1154450144 18:14469051-14469073 GGATGTTGAGAGGCTGAGGCAGG + Intergenic
1155094956 18:22546664-22546686 TGTTGGTGAGATACTGTGGCAGG - Intergenic
1155560763 18:27073625-27073647 TGATGCTGAGAGGCTGCTGCAGG + Intronic
1156294801 18:35779649-35779671 CGTTGGGGAGAGGCAGTGGTAGG + Intergenic
1156742953 18:40355069-40355091 GAATGGTGGGAGGCTGAGGCAGG + Intergenic
1158038494 18:53064499-53064521 CGATGGAGAGAGCTTGTGTCTGG - Intronic
1158865196 18:61631923-61631945 CCATGTTGGGAGGCTGAGGCAGG + Intergenic
1159594992 18:70374438-70374460 CTTTGGTGGGAGGCTGAGGCAGG + Intergenic
1160201021 18:76795548-76795570 TGGTGGTGGGAGGCTGAGGCAGG + Exonic
1160754561 19:750836-750858 CGGTGCTGAGAGGCGGTGGGAGG + Intergenic
1161107271 19:2450529-2450551 AGATGATGGGAGGCTGAGGCGGG + Intronic
1161861393 19:6801034-6801056 GGGTGGTGAGAGGGTGTGCCGGG - Intronic
1162071559 19:8155311-8155333 CAATGGGGTGAGGGTGTGGCTGG - Intronic
1162712125 19:12603238-12603260 CCATGTTGGGAGGCTGAGGCAGG + Intronic
1162972798 19:14191199-14191221 AGATGGGGACAGGCTGAGGCTGG - Intronic
1163095481 19:15054218-15054240 GCATGGTGGGAGGCTGAGGCAGG - Intronic
1163432552 19:17276905-17276927 GGAAGGTGAGAGGCTGCAGCAGG + Exonic
1163875066 19:19860992-19861014 CGGTGGGAAGTGGCTGTGGCGGG - Intergenic
1163898214 19:20078186-20078208 CGATGGGAAGTGGCTGTGGCGGG + Intronic
1163948828 19:20565564-20565586 CGGTGGGAAGTGGCTGTGGCGGG - Intronic
1163983474 19:20923454-20923476 CGGTGGGAAGCGGCTGTGGCGGG + Intronic
1164005219 19:21142238-21142260 CGGTGGGAAGTGGCTGTGGCGGG + Intronic
1164030278 19:21397320-21397342 CGGTGGGAAGTGGCTGTGGCGGG + Intronic
1164035630 19:21451567-21451589 GGGTGGTGGGAGGCTGAGGCAGG + Intronic
1164096031 19:22010717-22010739 CGGTGGGAAGTGGCTGTGGCGGG - Intronic
1164123204 19:22286607-22286629 CGGTGGGAAGTGGCTGTGGCGGG + Intronic
1164136558 19:22422120-22422142 CGGTGGGAAGAGGCTGTGGCGGG - Intronic
1164162201 19:22634527-22634549 CGGTGGCAAGAGGCTGTGGCGGG + Intronic
1164176980 19:22783940-22783962 CGGTGGAAAGTGGCTGTGGCGGG - Intronic
1164182581 19:22832434-22832456 CGGTGGGAAGTGGCTGTGGCGGG + Intergenic
1164199205 19:23002953-23002975 CGGTGGGAAGTGGCTGTGGCGGG - Intronic
1164213089 19:23117228-23117250 CGGTGGGAAGCGGCTGTGGCGGG + Intronic
1165243510 19:34484445-34484467 TCATGGTGAGACTCTGTGGCTGG + Intronic
1165577883 19:36837369-36837391 CACTGGTAAGAGGCTGTAGCTGG - Intronic
1165706902 19:37982779-37982801 GGAGGGAGAGAGGCTGGGGCTGG + Intronic
1165824633 19:38698732-38698754 CCATGGTGAGAGGTGGTGGTGGG + Intronic
1165859204 19:38898413-38898435 AGAGGGTGAGAGGCTGGGGGAGG + Exonic
1166390620 19:42407085-42407107 AGAGGGTGTGAGGCTGAGGCTGG + Intronic
1166403245 19:42499894-42499916 TGGTGGTGGGAGGCTGAGGCAGG + Intergenic
1166547259 19:43640683-43640705 AGAGGGAGAGAGGCTGGGGCAGG - Intergenic
1166865224 19:45831943-45831965 GGAGGCTGAGAGGCTGAGGCAGG - Intronic
1166991692 19:46696641-46696663 CTAGGGTGGGAGGCTGAGGCAGG + Intronic
1166991915 19:46697715-46697737 CGCTGGTGAGTGGCCGGGGCGGG - Exonic
1167069401 19:47211409-47211431 GCATGGTGGGAGGCTGTGGCGGG + Intergenic
1167503077 19:49858110-49858132 TGCTGGTGAGGGGCTGGGGCCGG + Exonic
1167604778 19:50475975-50475997 CGATCCTGGGAGGCTGTGCCTGG + Intronic
925311604 2:2888266-2888288 GGATGTTGAGAGGATGTGGTTGG - Intergenic
926334410 2:11852461-11852483 GCATGGTGGGAGGCTGAGGCAGG + Intergenic
927546527 2:23959077-23959099 GCATTTTGAGAGGCTGTGGCAGG - Intronic
928226950 2:29457911-29457933 AGATGCTGAAAGACTGTGGCTGG - Intronic
929111026 2:38405187-38405209 AGATGGTGGGAGGCCGAGGCAGG + Intergenic
930022228 2:47008435-47008457 GGATGGTGCCAGGCTGTGTCTGG - Intronic
930365685 2:50436377-50436399 CCATGGGCAGAGGCTGTGGTGGG + Intronic
931185393 2:59946014-59946036 TGATTAGGAGAGGCTGTGGCTGG - Intergenic
931460068 2:62442820-62442842 CTATGGGGAGAGCCTGGGGCAGG + Intergenic
932241288 2:70159021-70159043 CGGTGGCGGGAGGCTGAGGCAGG - Intronic
933553685 2:83806837-83806859 CCAAGGTGAGAGGCTTTGGTGGG + Intergenic
933807774 2:86012445-86012467 CAATGGGGAGAGGCTGCAGCAGG + Intergenic
935021373 2:99235788-99235810 CTATGTTGGGAGGCTGAGGCAGG + Intronic
935182995 2:100706732-100706754 CTATTGTGTGAGGCTATGGCAGG - Intergenic
936012888 2:108936364-108936386 GGGAGGGGAGAGGCTGTGGCTGG + Intronic
936075331 2:109398089-109398111 GGCTGGTGACCGGCTGTGGCAGG - Intronic
936430022 2:112454567-112454589 GCACTGTGAGAGGCTGTGGCAGG - Intergenic
936745856 2:115575632-115575654 CCATGTTGAAAGACTGTGGCAGG + Intronic
937200606 2:120201951-120201973 TGTTGGGGAGAGGCTGAGGCAGG + Intergenic
937456393 2:122045225-122045247 GGAGGCTGAGAGGCTGAGGCAGG - Intergenic
937759319 2:125581425-125581447 CAGTGGTGAGAGGCTGTGCTGGG - Intergenic
938405381 2:131029998-131030020 AGATGGTGTGAGGCTGTGCAGGG + Intronic
938481269 2:131663652-131663674 GGACGTTGAGAGGCTGAGGCAGG - Intergenic
940776224 2:157886655-157886677 GGAGGCTGAGAGGCTGAGGCAGG + Intronic
940788251 2:158005079-158005101 TGTTGGTGAGAGGTTGTGACAGG - Intronic
942247633 2:174022565-174022587 ACACTGTGAGAGGCTGTGGCGGG + Intergenic
943176231 2:184478187-184478209 GGGAGGTGAGAGGCTGAGGCGGG + Intergenic
943432766 2:187825301-187825323 CGAAGCTGAGGGGCTGTGGCCGG - Intergenic
944137479 2:196414853-196414875 CCAAGGTGAGAGGCTGTGGCTGG - Intronic
944216632 2:197263084-197263106 AGGGGGTGAGGGGCTGTGGCAGG - Intronic
944245170 2:197523347-197523369 CTAAGGTGAGAGGCTGAGGTGGG + Intronic
944343640 2:198634167-198634189 CACTGGTGGGAGGCTGAGGCAGG + Intergenic
945469761 2:210213932-210213954 GCATGTTGAGAGGCTGAGGCAGG + Intronic
946212763 2:218160872-218160894 GGGTGGTGAGAGGCTGTGGTTGG + Intergenic
946354883 2:219178351-219178373 CTATGGCGAGCGGCGGTGGCGGG + Exonic
946404503 2:219485121-219485143 CGCTGGAGAGAGGCTGTGGGAGG + Intronic
946633000 2:221691803-221691825 TGATGGAGAGTGGCTGGGGCTGG + Intergenic
947055232 2:226092267-226092289 CCTTGGGCAGAGGCTGTGGCAGG - Intergenic
947383888 2:229571370-229571392 AGATGGTGAGAGGGAGTGGGAGG - Intronic
947527925 2:230890769-230890791 AAGTAGTGAGAGGCTGTGGCTGG - Intergenic
948665502 2:239532246-239532268 CCTTGGTGAGAGGCTTTGGACGG - Intergenic
948814416 2:240502576-240502598 AGATGGGGAGGGGCTGTGGTTGG - Intronic
948879843 2:240851058-240851080 GGATGGTGAGAGACAGTGACAGG - Intergenic
1168897268 20:1332248-1332270 GGATTGTGGGAGGCTGAGGCAGG - Intronic
1171246101 20:23610951-23610973 CGATGATGGGAGGGTGTGGCAGG - Intergenic
1171858319 20:30370880-30370902 TGATGTTGAGAGGCTGAGACGGG - Intergenic
1172026791 20:31953951-31953973 GGATGGGGAGAGGCTGAGGGAGG + Intergenic
1172047100 20:32087886-32087908 GCATGGTGGGAGGCTGAGGCGGG - Intronic
1172335096 20:34109413-34109435 CCATGTTGGGAGGCTGAGGCAGG + Intronic
1172578836 20:36030849-36030871 GGATGGTCAGAGGCTGTGTGTGG + Intergenic
1173252914 20:41374079-41374101 GGATGGGGAGAGGCTGGGGGCGG + Intergenic
1174182322 20:48682680-48682702 CGGTGGTGAGAGGCTCAGCCGGG + Intronic
1174552843 20:51374034-51374056 GCATGGTGAGTGGCTGAGGCAGG - Intergenic
1174555348 20:51391327-51391349 AGAAGGTGAGGGGCTGTGGAGGG + Exonic
1175787084 20:61718476-61718498 CGCTGGTTAGAGGCAGTGCCAGG + Exonic
1175923087 20:62459065-62459087 CGAGGCTGCGAGGTTGTGGCTGG - Intergenic
1176268397 20:64222618-64222640 GGACTGTGAGAGGCTGTGCCTGG + Intronic
1176446042 21:6821310-6821332 GGATGTTGAGAGGCCGAGGCAGG - Intergenic
1176824208 21:13686343-13686365 GGATGTTGAGAGGCCGAGGCAGG - Intergenic
1177069615 21:16487184-16487206 GCATGTTGAGAGGCTGAGGCAGG - Intergenic
1177198108 21:17924085-17924107 TAAAGGTGAGAGGCTGTGGCTGG + Intronic
1178474404 21:32923934-32923956 CGATTGTCAGATGCTGGGGCAGG - Intergenic
1178724267 21:35037234-35037256 CGATGGTGACATGCTGGGGTGGG - Intronic
1178870466 21:36370094-36370116 TGGTGGTGGGAGGCTGAGGCAGG + Intronic
1178964262 21:37100717-37100739 TGAAGGGGAGAGGCTGCGGCAGG - Intronic
1179972157 21:44842234-44842256 CGGGGGTGAGGGGCTGTTGCTGG - Intergenic
1180185027 21:46135242-46135264 CAATGGTGAGCGGCAGTTGCTGG - Intergenic
1180840746 22:18957775-18957797 CCAAGGTGAGGAGCTGTGGCTGG + Intergenic
1181063040 22:20291046-20291068 GGCTGGAGAGAGGGTGTGGCCGG + Intergenic
1181441699 22:22939336-22939358 CACTGGTGAGAGGCAGGGGCAGG + Intergenic
1183054025 22:35290517-35290539 CGCCTGTGAGAGGCTGAGGCAGG + Intronic
1183303627 22:37070578-37070600 CGAGGGTGAGTGGCCATGGCAGG - Exonic
1183350433 22:37331777-37331799 CCAGGGTGACAGGCTTTGGCTGG - Intergenic
1183581547 22:38729430-38729452 CCATGGAGAGAGGCTGAGGCTGG - Intronic
1183730711 22:39617043-39617065 GAATGGAGGGAGGCTGTGGCAGG + Intronic
1183749003 22:39708686-39708708 CAAAGGTGAGTGGCTGGGGCTGG - Intergenic
1184119156 22:42439091-42439113 CCAGGCTGAGAGGCTGAGGCTGG + Intergenic
1184767701 22:46580159-46580181 TGAGGGAGAGAAGCTGTGGCCGG + Intronic
1184807760 22:46806782-46806804 CGGAGGTGAGTGCCTGTGGCTGG + Intronic
1184902966 22:47458788-47458810 CCATTTTGAGAGGCTGAGGCAGG + Intergenic
1185212077 22:49575967-49575989 GGATGGAGGGAGGCTGTGGCCGG - Intronic
1185388402 22:50546911-50546933 CGATGGGGAGAGGCCGGGGCCGG + Intergenic
950124561 3:10503469-10503491 CGCCTGTGTGAGGCTGTGGCGGG + Intronic
950182768 3:10926912-10926934 CGAGGCGGGGAGGCTGTGGCTGG - Intronic
950261089 3:11543875-11543897 GGATGGTGACAGGCTGGGGATGG + Intronic
952385034 3:32834595-32834617 GGATGGTGGGAGGCCGAGGCGGG + Intronic
952904386 3:38129926-38129948 CCAGGGTGGGAGGCTGAGGCAGG + Intronic
953040737 3:39252927-39252949 GCATGGTGAGAAGCTGGGGCAGG + Intergenic
954588027 3:51753770-51753792 CAATGGGGTGAGGGTGTGGCAGG + Intergenic
955399605 3:58581967-58581989 GGATGGTGAGAGGATGTGAGAGG + Intronic
955571262 3:60309300-60309322 GGATGGTTAGAGGCTCTGGGAGG + Intronic
955947919 3:64213186-64213208 AGATGGTGGAAGGCTGAGGCAGG - Intronic
956092893 3:65687146-65687168 CTATCTTGAGAGGCTGAGGCAGG + Intronic
956348145 3:68303550-68303572 GGAGGCTGAGAGGCTGAGGCGGG - Intronic
957494643 3:80976469-80976491 AGATTTTGAGAGGCTGAGGCAGG + Intergenic
961699661 3:128732713-128732735 AGATGGTGGGAGGCTGAGACGGG + Intronic
962749639 3:138424420-138424442 TCAGGGTAAGAGGCTGTGGCTGG + Intergenic
963443147 3:145367039-145367061 CCATGGTTGGTGGCTGTGGCTGG - Intergenic
963588507 3:147226497-147226519 CCATTTTGAGAGGCTGAGGCAGG + Intergenic
967130886 3:186469732-186469754 CGATGGAGGGAAGCTGGGGCAGG - Intergenic
967135043 3:186505973-186505995 CTATGGGGGGAGGCTGAGGCAGG + Intergenic
969465045 4:7351330-7351352 GGAGGGAGAAAGGCTGTGGCAGG - Intronic
969532988 4:7739923-7739945 CGCAGGTCAGTGGCTGTGGCGGG + Intronic
970548060 4:17149599-17149621 GGATGGTGTGAGGCAGTGGTCGG - Intergenic
970682860 4:18531602-18531624 AGCTGGAGAGAGTCTGTGGCAGG + Intergenic
970913757 4:21308838-21308860 GGAGGGTGAGAGGCTGTTTCAGG + Intronic
971588171 4:28432328-28432350 CCATGGGCATAGGCTGTGGCAGG + Intergenic
972466911 4:39366221-39366243 CGATGGTGAGCCGCTGGGGGAGG - Exonic
973330308 4:48905932-48905954 CAATGGTGAGGGGCTCTTGCAGG + Intronic
974282040 4:59807645-59807667 CAATTGTGGGAGGCTGAGGCAGG + Intergenic
978002967 4:103579480-103579502 CAATGTTGGGAGGCTGAGGCAGG + Intergenic
979419570 4:120487340-120487362 GCATGGTGGGAGGCTGAGGCAGG + Intergenic
979869483 4:125800928-125800950 TGATGGTGAGATGATGTGGCAGG - Intergenic
980846376 4:138330104-138330126 CTAATGGGAGAGGCTGTGGCTGG - Intergenic
982268007 4:153557906-153557928 CAGTGGTGGGAGGCTGAGGCAGG - Intronic
983246333 4:165291939-165291961 CCATGTTGAGAGGCTGAGGCAGG - Intronic
985662023 5:1162058-1162080 GGTTGGGGTGAGGCTGTGGCTGG + Intergenic
985729473 5:1539273-1539295 TGAGGGTGAGAGGCAGAGGCAGG - Intergenic
986299410 5:6466362-6466384 GGAAGGGGAGAGGCTGTGGGAGG - Intronic
986787179 5:11125213-11125235 CTAGAGAGAGAGGCTGTGGCTGG - Intronic
988521707 5:31951312-31951334 CTATTTTGAGAGGCTGAGGCAGG - Intronic
989604513 5:43231069-43231091 GGATTTTGAGAGGCTGAGGCTGG + Intronic
989630391 5:43476263-43476285 GGTTGGTGAGAGGCTGATGCAGG + Intronic
990378045 5:55192833-55192855 CTATGGTGAGAGGTAGTGACTGG - Intergenic
991558310 5:67921367-67921389 AGAAGGTGCCAGGCTGTGGCAGG + Intergenic
991903788 5:71487647-71487669 GGATGGTGAGAGCCTGTGTTGGG + Intronic
997602022 5:135146895-135146917 CTATGGTGAGATGCTGTAACTGG - Intronic
998045162 5:138981099-138981121 AGAGGCTGAGAGGCTGAGGCAGG + Intronic
998083079 5:139293003-139293025 CAATGCTGAGAGGCGGAGGCGGG + Intronic
998094684 5:139390548-139390570 GGGTGTTGAGAGGCTGTGGCAGG + Intergenic
998757581 5:145397949-145397971 CAATGGTGTGAGGCGATGGCTGG + Intergenic
999179125 5:149656541-149656563 CTGTGGTGGGAGGCTGAGGCGGG - Intergenic
999440440 5:151596576-151596598 AGAGGGTGATAGGCTGTAGCTGG - Intergenic
1002023378 5:176380586-176380608 GGAGGCTGAGAGGCTGAGGCAGG - Exonic
1002187199 5:177459882-177459904 GGCTGGTGTGAGGCTGCGGCTGG - Intronic
1002641826 5:180634070-180634092 AGCTGGAGAGAGGCAGTGGCTGG - Intronic
1003029699 6:2591357-2591379 CCAAGGTGAGATGCTGTTGCTGG + Intergenic
1004712187 6:18182650-18182672 CTGTGGTGAGAGGCTGAGTCAGG - Intronic
1005821099 6:29599944-29599966 TGATGGTGAGTTGCTGTGGCAGG - Intronic
1006028365 6:31161763-31161785 AGAAGGTGAGGGGCTGGGGCCGG - Exonic
1006388050 6:33742966-33742988 AGATGGTGGGAGGCGATGGCTGG + Intronic
1006582304 6:35084042-35084064 CAATGGTAACAGGCTGGGGCAGG + Intronic
1006723903 6:36181960-36181982 GCATGGTGGGAGGCTGAGGCAGG + Intergenic
1007176525 6:39901468-39901490 CCATGGTGAGGGGCAGTGCCAGG + Exonic
1007211594 6:40197083-40197105 CAGTGGTGAGGGGATGTGGCTGG + Intergenic
1007481597 6:42153881-42153903 TGCCGGTCAGAGGCTGTGGCAGG + Intergenic
1011441017 6:87387458-87387480 CTACGATGAGAGGCTGAGGCAGG + Intronic
1011608959 6:89131808-89131830 CTCTGGCTAGAGGCTGTGGCAGG - Intergenic
1013060325 6:106627862-106627884 TGTTGGTGGGAGGCTGAGGCAGG - Intronic
1013202425 6:107912326-107912348 ACATGGTGGGAGGCTGAGGCAGG + Intronic
1013819079 6:114134011-114134033 CGGTAGTGGGAGGCGGTGGCTGG + Intronic
1014922957 6:127234176-127234198 GGAGGGTGAGAGGCTATGGGAGG + Intergenic
1015677296 6:135764294-135764316 GAATGGTGGGAGGCTGAGGCAGG - Intergenic
1015890774 6:137967832-137967854 TGATGGGGACAGGCTGGGGCTGG - Intergenic
1016977627 6:149824610-149824632 GCATGGTGGGAGGCTGAGGCAGG + Intronic
1017321316 6:153097408-153097430 CTATTGTGGGAGGCTGCGGCAGG - Intronic
1017936467 6:159009945-159009967 AGAAGGTGAGAAGCTGGGGCTGG + Intergenic
1018330920 6:162727288-162727310 CGAAGGTGAGGGGCGGCGGCGGG + Intronic
1018330929 6:162727312-162727334 CGAAGGTGAGGGGCGGCGGCGGG + Intronic
1018838668 6:167503725-167503747 GGATGGAGGGAGGCAGTGGCTGG - Intergenic
1018994941 6:168703421-168703443 GGATGGTGAGAGTTTGTGGGTGG - Intergenic
1020930825 7:14391433-14391455 AGATTTTGAGAGGCTGAGGCAGG + Intronic
1022109447 7:27219554-27219576 GGATGGGGAGGGGCTGTGGAGGG + Intergenic
1023061366 7:36330330-36330352 CCAAGGTGGGAGGCTGAGGCAGG - Intronic
1024563491 7:50663424-50663446 CGATGGTGAGAGGCTGTGGCAGG - Intronic
1025016075 7:55440075-55440097 CGCTGGTGAGAGCGGGTGGCAGG + Intronic
1025788517 7:64666338-64666360 CGATCGGAAGTGGCTGTGGCTGG + Intronic
1025865126 7:65374053-65374075 CGATTGGAAGTGGCTGTGGCGGG + Intronic
1026548660 7:71347677-71347699 TGATGGTGAGAGTCTGGGGAGGG + Intronic
1026997500 7:74627809-74627831 AGCTGGTAAGAGGCTGAGGCTGG - Intergenic
1027129657 7:75581971-75581993 TGATGGGGGGAGGCCGTGGCTGG - Intronic
1028237163 7:88376206-88376228 GGATGCTGAGATGCTGAGGCGGG - Intergenic
1032324109 7:130910520-130910542 CAATGCTGTGAGGCTGTTGCGGG - Intergenic
1032965601 7:137093674-137093696 TGGTGGTGGGAGGCTGTGGGTGG - Intergenic
1034068447 7:148159259-148159281 CGATGGCGAGAGGGTGAAGCTGG - Intronic
1034202519 7:149291291-149291313 GCATGTTCAGAGGCTGTGGCCGG + Intronic
1034252677 7:149704954-149704976 TGATGCTAAGAGGCTGGGGCTGG + Intergenic
1034458634 7:151186157-151186179 GGGTGGAGGGAGGCTGTGGCAGG - Intronic
1035062652 7:156080338-156080360 GGAAGAGGAGAGGCTGTGGCGGG - Intergenic
1036678780 8:10855397-10855419 GGATGGGGTGAGGCTGTGGCTGG - Intergenic
1037879220 8:22565069-22565091 GGCAGGTGAGAGGCCGTGGCGGG + Intronic
1038318844 8:26510694-26510716 GCACTGTGAGAGGCTGTGGCGGG - Intronic
1038580954 8:28748860-28748882 ACATGTTGAGAGGCTGAGGCAGG + Intronic
1039059775 8:33564459-33564481 CTATGCTGGGAGGCTGAGGCAGG + Intronic
1039891356 8:41687840-41687862 CTATGGTCTGTGGCTGTGGCTGG - Intronic
1040776922 8:51056253-51056275 CCATTTTGAGAGGCTGAGGCCGG - Intergenic
1041560834 8:59215833-59215855 TCATGGGTAGAGGCTGTGGCTGG + Intergenic
1044713706 8:95081274-95081296 AGAGGCTGAGAGGCTGAGGCAGG - Intronic
1046195990 8:110863073-110863095 GGATGGGGAGGGGCTGTGGAAGG - Intergenic
1046944228 8:119959636-119959658 CTGTGGTGGGAGGCTGAGGCAGG - Intronic
1048854977 8:138679025-138679047 CTATGGAGGGAGGCTGAGGCAGG - Intronic
1049216288 8:141409830-141409852 CGCTGGCGAGGGGCCGTGGCTGG + Intronic
1049261613 8:141642005-141642027 GGGTGGGGAGAGGCTGTGGATGG + Intergenic
1049302338 8:141878253-141878275 AGGCGGTGAAAGGCTGTGGCTGG + Intergenic
1049441523 8:142611913-142611935 CCATGGGGAGGGGCTGGGGCCGG + Intronic
1051466421 9:17383280-17383302 AGATTTTGAGAGGCTGAGGCAGG + Intronic
1054341387 9:63865903-63865925 TGATGTTGAGAGGCTGAGACGGG + Intergenic
1054802453 9:69363850-69363872 GTGTGGAGAGAGGCTGTGGCAGG + Intronic
1054803566 9:69376967-69376989 TGCTGGTGGGAGGCTGTGGGAGG + Intronic
1056206117 9:84320852-84320874 TGGTGGTGGGAGGCTGAGGCAGG + Intronic
1058905139 9:109476795-109476817 TGGTGTTGAGTGGCTGTGGCGGG - Intronic
1059525350 9:114986182-114986204 AGATGGTGGGCAGCTGTGGCAGG - Intergenic
1059822102 9:117984758-117984780 GGTTGGGGAGAGGCTGTGGGAGG - Intergenic
1061835619 9:133327398-133327420 CGATACTGGGAGGCTGAGGCAGG - Intergenic
1062413151 9:136434722-136434744 AGAAGGTGAGTGGCTGTGGGTGG - Exonic
1062684417 9:137802928-137802950 AGCTGGTGGAAGGCTGTGGCGGG + Intronic
1203523151 Un_GL000213v1:63215-63237 GGATGTTGAGAGGCCGAGGCAGG + Intergenic
1187331167 X:18341118-18341140 CCATGGTGAGAGGCACTGGCAGG + Intronic
1189784186 X:44544418-44544440 GGATGTTGGGAGGCTGAGGCAGG - Intergenic
1190326740 X:49211149-49211171 GGATGGTGGGAGGCTGGGGCGGG + Intronic
1193440781 X:81537426-81537448 CCTTGGGCAGAGGCTGTGGCTGG + Intergenic
1194193157 X:90861291-90861313 CGGACCTGAGAGGCTGTGGCAGG - Intergenic
1195069473 X:101265391-101265413 GTTTGGTGAGAGGCTGAGGCAGG - Intergenic
1200539771 Y:4443741-4443763 CGGACCTGAGAGGCTGTGGCAGG - Intergenic