ID: 1024563492

View in Genome Browser
Species Human (GRCh38)
Location 7:50663428-50663450
Sequence GACTCGATGGTGAGAGGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 220}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024563492_1024563503 23 Left 1024563492 7:50663428-50663450 CCACAGCCTCTCACCATCGAGTC 0: 1
1: 0
2: 0
3: 12
4: 220
Right 1024563503 7:50663474-50663496 GTGACTAGGGTCCTTCTCACAGG No data
1024563492_1024563500 9 Left 1024563492 7:50663428-50663450 CCACAGCCTCTCACCATCGAGTC 0: 1
1: 0
2: 0
3: 12
4: 220
Right 1024563500 7:50663460-50663482 GGGATGAGTGCCATGTGACTAGG 0: 1
1: 0
2: 1
3: 11
4: 134
1024563492_1024563504 24 Left 1024563492 7:50663428-50663450 CCACAGCCTCTCACCATCGAGTC 0: 1
1: 0
2: 0
3: 12
4: 220
Right 1024563504 7:50663475-50663497 TGACTAGGGTCCTTCTCACAGGG 0: 1
1: 0
2: 2
3: 22
4: 218
1024563492_1024563501 10 Left 1024563492 7:50663428-50663450 CCACAGCCTCTCACCATCGAGTC 0: 1
1: 0
2: 0
3: 12
4: 220
Right 1024563501 7:50663461-50663483 GGATGAGTGCCATGTGACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024563492 Original CRISPR GACTCGATGGTGAGAGGCTG TGG (reversed) Intronic
900127750 1:1075915-1075937 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900127768 1:1075975-1075997 GACTCCGTGGCGGGAGGCTGAGG + Intergenic
900127779 1:1076005-1076027 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900127787 1:1076035-1076057 GACTCCGTGCTGGGAGGCTGAGG + Intergenic
900127807 1:1076095-1076117 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900127852 1:1076243-1076265 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900127863 1:1076273-1076295 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900127874 1:1076303-1076325 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900127882 1:1076333-1076355 GACTCCGTGCTGGGAGGCTGAGG + Intergenic
900127902 1:1076393-1076415 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900127947 1:1076541-1076563 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900127958 1:1076571-1076593 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900127969 1:1076601-1076623 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900127980 1:1076631-1076653 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900127991 1:1076661-1076683 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128002 1:1076691-1076713 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128013 1:1076721-1076743 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128024 1:1076751-1076773 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128035 1:1076781-1076803 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128046 1:1076811-1076833 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128057 1:1076841-1076863 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128068 1:1076871-1076893 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128079 1:1076901-1076923 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128090 1:1076931-1076953 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128101 1:1076961-1076983 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128112 1:1076991-1077013 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128123 1:1077021-1077043 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128134 1:1077051-1077073 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128229 1:1077381-1077403 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128240 1:1077411-1077433 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128251 1:1077441-1077463 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128262 1:1077471-1077493 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128344 1:1077741-1077763 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128355 1:1077771-1077793 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128366 1:1077801-1077823 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128396 1:1077891-1077913 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128407 1:1077921-1077943 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128418 1:1077951-1077973 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128429 1:1077981-1078003 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128487 1:1078161-1078183 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128498 1:1078191-1078213 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128509 1:1078221-1078243 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128539 1:1078311-1078333 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128550 1:1078341-1078363 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128561 1:1078371-1078393 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128572 1:1078401-1078423 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128583 1:1078431-1078453 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128594 1:1078461-1078483 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128605 1:1078491-1078513 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128616 1:1078521-1078543 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128627 1:1078551-1078573 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128638 1:1078581-1078603 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128649 1:1078611-1078633 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128660 1:1078641-1078663 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128680 1:1078701-1078723 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128691 1:1078731-1078753 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128712 1:1078791-1078813 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128741 1:1078881-1078903 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128770 1:1078971-1078993 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128790 1:1079031-1079053 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128801 1:1079061-1079083 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128812 1:1079091-1079113 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128841 1:1079181-1079203 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128863 1:1079241-1079263 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128885 1:1079301-1079323 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128905 1:1079361-1079383 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900128916 1:1079391-1079413 GACTCCGTGGGGGGAGGCTGAGG + Intergenic
900595999 1:3480451-3480473 GGCTCTATGGCGAGAGGCTCCGG + Exonic
901657307 1:10776847-10776869 CACTGGATGGTGAGAAGGTGAGG - Intronic
904197489 1:28796639-28796661 GACATGAGGGTGGGAGGCTGGGG + Intergenic
905323654 1:37134849-37134871 GACAAGATGCTGAGAGCCTGAGG + Intergenic
910549798 1:88462938-88462960 GCCTCGATGGCGAGAGGCCCAGG + Intergenic
911093669 1:94038147-94038169 GAAGCCATGGAGAGAGGCTGGGG + Intronic
912441775 1:109704448-109704470 GACAGGAGGGTGAGGGGCTGCGG - Intronic
912571922 1:110631088-110631110 GACTCTAGGGTGAGGGGATGGGG - Intronic
915930436 1:160057569-160057591 GACAAGAGGGCGAGAGGCTGAGG - Intronic
916074214 1:161191027-161191049 GACTCAGTGGGGAGGGGCTGTGG - Exonic
916826674 1:168448572-168448594 GACTCAATGTAGAGAGGTTGGGG - Intergenic
917789110 1:178488179-178488201 GTCTCTCAGGTGAGAGGCTGAGG - Intergenic
919660217 1:200236802-200236824 GATTGGATGGTGAGAAGCTGGGG - Intergenic
922157998 1:223054894-223054916 GACAGGATGGTGAGAGCATGTGG - Intergenic
922556829 1:226539020-226539042 GACCCGATGCTGGAAGGCTGTGG - Intergenic
924264531 1:242268044-242268066 GCTTGGATGGTGAGAGGCTCAGG + Intronic
924424255 1:243936162-243936184 GGCTGCATGGTGAGTGGCTGGGG + Intergenic
1064828894 10:19439419-19439441 GTCCTGATGGTGGGAGGCTGAGG + Intronic
1070502914 10:77088511-77088533 GACTTGATCCTGAGAGGCAGAGG - Intronic
1070841760 10:79492313-79492335 GACCCGGTGGTGTGAGACTGAGG - Intergenic
1071552176 10:86574948-86574970 GACTTGAGCCTGAGAGGCTGAGG - Intergenic
1073354497 10:102843229-102843251 GACAGGAGGGTGAGGGGCTGTGG + Intergenic
1074123815 10:110512619-110512641 GACCAGATGGTGAGAAGTTGTGG + Intergenic
1074135249 10:110620118-110620140 GTCTTGAAGGGGAGAGGCTGGGG - Intergenic
1074489291 10:113924528-113924550 GACAGGCTGGGGAGAGGCTGAGG + Intergenic
1076296903 10:129392529-129392551 GCCTCCATGTTGAGGGGCTGGGG - Intergenic
1076770090 10:132657987-132658009 GACGCGATGATGTGCGGCTGGGG + Intronic
1077284287 11:1758920-1758942 GACTCGAGGGTGCCAGGGTGTGG - Intronic
1077700034 11:4432570-4432592 TTCTCTATGGTGACAGGCTGTGG + Intergenic
1084223607 11:67700380-67700402 GACAGGAGGGTGAGGGGCTGTGG - Intergenic
1084272386 11:68036247-68036269 GCCTCGATGGTGATGGCCTGCGG - Exonic
1084570825 11:69958851-69958873 GTCTCAGTGTTGAGAGGCTGTGG - Intergenic
1085037480 11:73308863-73308885 GAACCGACGGCGAGAGGCTGCGG - Exonic
1096217448 12:49805869-49805891 GGCTCGATGGTGAGCTGCTGAGG - Intronic
1097002977 12:55893793-55893815 CAATCAATTGTGAGAGGCTGAGG - Intergenic
1103431063 12:120887087-120887109 GGCGTGATGGTGGGAGGCTGAGG - Intronic
1104146199 12:126036150-126036172 GACTCCATGGGGAGAGGTTGAGG - Intergenic
1106360286 13:29025281-29025303 GAGTCGAGGGATAGAGGCTGTGG - Exonic
1114617941 14:24078088-24078110 GGCATGATGGTTAGAGGCTGAGG - Exonic
1118425544 14:65656971-65656993 GCGTATATGGTGAGAGGCTGGGG - Intronic
1124143709 15:27100876-27100898 AACTTGATGGTGAAAGACTGAGG + Intronic
1124524119 15:30432787-30432809 GACTCGATGGAAAGATGCAGAGG - Intergenic
1124534547 15:30533429-30533451 GACTCGATGGAAAGATGCAGAGG + Intergenic
1124646627 15:31441549-31441571 GACTTGGTGGCGGGAGGCTGAGG - Intergenic
1124764101 15:32474170-32474192 GACTCGATGGAAAGATGCAGAGG - Intergenic
1124774533 15:32574881-32574903 GACTCGATGGAAAGATGCAGAGG + Intergenic
1127738383 15:61870233-61870255 GATTTGGTGGGGAGAGGCTGGGG - Intronic
1127758237 15:62113447-62113469 GGTTTGCTGGTGAGAGGCTGTGG - Intergenic
1128158070 15:65404272-65404294 GAGCTGAGGGTGAGAGGCTGGGG - Intronic
1130363302 15:83209642-83209664 GACTTGAGGGTGAGAGGCTTGGG + Intergenic
1131406816 15:92171842-92171864 GACTCCTTTGTGAGAAGCTGAGG + Intronic
1132712945 16:1277327-1277349 GACCCCATGGTGGGAGGCAGAGG - Intergenic
1136385850 16:29925714-29925736 GCCCCGGTGGTGAGAGACTGCGG + Intronic
1136391741 16:29969717-29969739 CACTCCATGTTGAGAGGCTTAGG + Intronic
1138347148 16:56326991-56327013 AACCCGATGGTGAGTGGCAGGGG - Intronic
1140743945 16:77964721-77964743 GAATAGATGGTGAGGGGTTGGGG - Intronic
1141670675 16:85490176-85490198 CGCTAGATGTTGAGAGGCTGAGG + Intergenic
1141699244 16:85634935-85634957 GACTCGCTGCTGACAGGCGGGGG + Intronic
1142677262 17:1521495-1521517 GACTCCATAGTGAGCTGCTGAGG + Intronic
1143125853 17:4640583-4640605 GACTCCATGGTGAGGGGACGGGG - Intronic
1143402625 17:6656239-6656261 GACTCCATGGTGAGGGGACGGGG + Intergenic
1144497154 17:15755562-15755584 GACTCAATGGTGATAGGCGAAGG - Intergenic
1147399217 17:40169411-40169433 GGCTTGATGGTGACTGGCTGGGG - Exonic
1147406618 17:40217105-40217127 GACACGGTGGTGTGAGCCTGTGG - Intergenic
1148321764 17:46760379-46760401 GTCCCAATGCTGAGAGGCTGAGG + Intergenic
1149226498 17:54477726-54477748 GCGTCCATGGAGAGAGGCTGAGG + Intergenic
1149854829 17:60072758-60072780 GAATCGAGGGTGAGCAGCTGGGG + Intronic
1203163081 17_GL000205v2_random:69505-69527 GACCCGATGCTGGGAGGCCGTGG + Intergenic
1153718158 18:7872247-7872269 GAATGGATACTGAGAGGCTGGGG - Intronic
1158171956 18:54610010-54610032 GACTTGGTGGTGACACGCTGTGG + Intergenic
1160585070 18:79909604-79909626 GACTCTGTGGTGAGATGCTGGGG - Intronic
1160585138 18:79909854-79909876 GACTCTGTGGTGAGATGGTGGGG - Intronic
1160585147 18:79909886-79909908 GACTCTATGGTGAGGGTGTGGGG - Intronic
1160585209 18:79910096-79910118 GACTCTATGGTGAGGGTGTGGGG - Intronic
1160585311 18:79910436-79910458 GACTCTATGGTGAGGGTGTGGGG - Intronic
1162817066 19:13202172-13202194 GGCTCGAGGCTGCGAGGCTGAGG + Intergenic
1163897079 19:20068661-20068683 GACCCGATGCTGGAAGGCTGTGG + Intergenic
1163938107 19:20469244-20469266 GACCCGATGCTGGAAGGCTGTGG - Intergenic
1166817860 19:45557595-45557617 GACACGCAGCTGAGAGGCTGTGG - Intronic
1166850092 19:45755807-45755829 GTCACGTTGGTGTGAGGCTGAGG - Intronic
1166991917 19:46697719-46697741 GACACGCTGGTGAGTGGCCGGGG - Exonic
1167292128 19:48630178-48630200 GAGTGGATGGGGCGAGGCTGCGG - Exonic
1167377831 19:49120871-49120893 GATTGGAAGGTGAGAGCCTGAGG - Intronic
1168174717 19:54617055-54617077 GACTCAGTGGTGAGACCCTGTGG + Intronic
1168246141 19:55114004-55114026 GTCTGAATGGGGAGAGGCTGGGG - Intronic
1168465148 19:56595569-56595591 GACTGGAGGCTGAGGGGCTGAGG + Intronic
925187674 2:1860368-1860390 CACGCGAGGGCGAGAGGCTGGGG - Intronic
932176174 2:69604793-69604815 GACTCCATGCAGAGAGGCTGGGG - Intronic
933703329 2:85271918-85271940 GACTCAATGGAGAGAGGATTTGG + Intronic
938104182 2:128519223-128519245 GTGTCCATGGAGAGAGGCTGAGG - Intergenic
938726515 2:134113426-134113448 GTCTTGCTGGAGAGAGGCTGGGG + Intergenic
941636443 2:167940166-167940188 GGGATGATGGTGAGAGGCTGTGG - Intergenic
941638371 2:167960771-167960793 GACTCTATGGTGGGGGGGTGGGG - Intronic
944783332 2:203042376-203042398 GACTCCATGGGGAGAGGGCGTGG - Intronic
1168792928 20:592073-592095 GACTGGAAGTTGGGAGGCTGTGG - Intergenic
1170937228 20:20820847-20820869 GGCTCCCTGGTGAGAGGGTGAGG - Intergenic
1171335961 20:24385808-24385830 GACTTCATTGTGAGAGGTTGTGG + Intergenic
1172026788 20:31953947-31953969 GCCTGGATGGGGAGAGGCTGAGG + Intergenic
1172127910 20:32636132-32636154 GCCTGGATGGTGAGCTGCTGGGG + Intergenic
1174106629 20:48166806-48166828 GGGTGGATGGAGAGAGGCTGGGG + Intergenic
1174192166 20:48748357-48748379 GACTAGATGGTTTGGGGCTGGGG - Intronic
1174503108 20:50999897-50999919 GACTGGATGGGGAGGGGGTGAGG + Intergenic
1178964263 21:37100721-37100743 GATTTGAAGGGGAGAGGCTGCGG - Intronic
1180092346 21:45539560-45539582 GACTGAATGCTGAGAGCCTGGGG - Intronic
1184113974 22:42411427-42411449 CACTCCACGGTGAGAGGCAGCGG - Exonic
1185273964 22:49941947-49941969 GTCCCCTTGGTGAGAGGCTGGGG - Intergenic
1185388401 22:50546907-50546929 GGCTCGATGGGGAGAGGCCGGGG + Intergenic
949599395 3:5581644-5581666 GACTCAATGCTAGGAGGCTGTGG + Intergenic
949974548 3:9443976-9443998 CACTCGAACCTGAGAGGCTGAGG + Intronic
952843561 3:37668179-37668201 TTCTAGATGGTGAGAGGATGGGG + Intronic
953830680 3:46295229-46295251 GAGTCGGTGGTGACAAGCTGAGG - Intergenic
954303578 3:49714006-49714028 GACTCGAGGGGAAGTGGCTGAGG + Intronic
954574608 3:51668961-51668983 GACTAGACAGTGAGTGGCTGGGG + Intronic
954954605 3:54508201-54508223 GGCCAGGTGGTGAGAGGCTGTGG + Intronic
957946239 3:87067094-87067116 GACTTGCTGGTGAGGGGCTTGGG - Intergenic
958053973 3:88385825-88385847 GACTTGAAGGTGAAAGGATGAGG + Intergenic
958689900 3:97450956-97450978 TTCTGGAGGGTGAGAGGCTGGGG + Intronic
960723775 3:120649871-120649893 GACTCGGTGGTGAAACACTGTGG + Intronic
961386432 3:126525615-126525637 GACTCGGTGGACAGAGGCTGTGG - Intronic
962347314 3:134627644-134627666 GCCACTATGCTGAGAGGCTGGGG - Intronic
971955432 4:33411365-33411387 GACTCAATGGTGACATACTGTGG + Intergenic
972590680 4:40483337-40483359 GATTGGATGGTGACAGGCAGAGG + Intronic
974594835 4:64001399-64001421 GACTCAGTGGTGAGAAACTGTGG - Intergenic
976850594 4:89540954-89540976 GACTGGAATGTAAGAGGCTGGGG - Intergenic
977250191 4:94680752-94680774 GACTTGATGGTGAAATGCTTTGG - Intergenic
982131093 4:152229298-152229320 GCCTCGATGGGGGTAGGCTGAGG + Intergenic
982284886 4:153724551-153724573 GACTTGGGGGTGAGAGGGTGGGG - Intronic
984349349 4:178570616-178570638 GACTCAAGGGTGAGTGGGTGGGG - Intergenic
984371500 4:178872281-178872303 GGCTCGGTGGTGAGTGCCTGTGG + Intergenic
987784790 5:22486081-22486103 CACTTGATGAGGAGAGGCTGAGG - Intronic
991202084 5:64006386-64006408 GACTACAAGGTGAGAGGTTGGGG + Intergenic
994408653 5:99378591-99378613 GACACTGTGGTGAGAGGGTGTGG - Intergenic
998107496 5:139477624-139477646 GACTCTATCGTTACAGGCTGAGG - Intronic
1000827184 5:166059495-166059517 GACTTGAGCCTGAGAGGCTGAGG - Intergenic
1001001816 5:168014755-168014777 GACTTGAAAATGAGAGGCTGTGG + Intronic
1001313467 5:170627190-170627212 GAGTGAATGGTGAGGGGCTGCGG - Intronic
1002639924 5:180625917-180625939 CACTGGATGCTGAGAGGCAGGGG + Exonic
1004611095 6:17240239-17240261 GGCTTGATGCTGAGAGGCGGAGG - Intergenic
1009816261 6:68739565-68739587 GACATGATGGTGAGAGCCTTTGG + Intronic
1011406209 6:87018018-87018040 GAAGAGATGGGGAGAGGCTGTGG - Intergenic
1019935683 7:4255819-4255841 CACTCGATAGTGAGAGTCTGTGG - Intronic
1020189126 7:5981382-5981404 GACTTGATGGTGTGTGCCTGTGG - Intronic
1024234432 7:47387274-47387296 GAGTGGATGGAGAGAGACTGGGG + Intronic
1024563492 7:50663428-50663450 GACTCGATGGTGAGAGGCTGTGG - Intronic
1032343492 7:131097829-131097851 GACTTGACAGTGTGAGGCTGGGG - Intergenic
1032458497 7:132092371-132092393 GACTCCATGGTGAGGAGCAGAGG - Intergenic
1036446836 8:8829016-8829038 CACTTGAATGTGAGAGGCTGGGG - Intronic
1038922440 8:32099643-32099665 GATTGGAAGGTGAGAGTCTGAGG + Intronic
1042176870 8:66045959-66045981 GACTGGGTGGTGACAGGATGGGG - Intronic
1045614446 8:103892340-103892362 GGCTCGGTGGTGAAAGCCTGTGG - Intronic
1047211908 8:122847372-122847394 GACTGGAAGGTGACAGGCAGAGG - Intronic
1048048867 8:130798387-130798409 GAGTCGAGGGAGAGAGGATGGGG + Intronic
1048581240 8:135731391-135731413 GCCTGGATGGGCAGAGGCTGGGG + Intergenic
1048828678 8:138454879-138454901 GACACGAAGGTGAGAAACTGTGG - Intronic
1049441521 8:142611909-142611931 GGCTCCATGGGGAGGGGCTGGGG + Intronic
1049795578 8:144495967-144495989 GACTGGGCAGTGAGAGGCTGGGG + Intronic
1052445122 9:28551836-28551858 GACATAATGATGAGAGGCTGAGG - Intronic
1053430717 9:38040212-38040234 AACTCGATGGGGAAAGGCTGGGG + Intronic
1053477816 9:38394664-38394686 GGGTGGAGGGTGAGAGGCTGGGG + Intronic
1056961682 9:91130201-91130223 GACTCGATGCTGAAGGGCTTAGG - Intergenic
1057064784 9:92038609-92038631 GACTCCCTGGTGGGAGGCTGGGG - Intronic
1057633920 9:96745272-96745294 GGCACGATGGTGAGTGCCTGTGG - Intergenic
1058007649 9:99935841-99935863 GACTCTGAGGTGAGAGGATGTGG + Intronic
1060673926 9:125495228-125495250 GACTCGAGAGTCAGAGGATGAGG + Intronic
1199186244 X:144919113-144919135 GACTCAATGGTGACACACTGTGG - Intergenic
1201475826 Y:14379686-14379708 GACAGGAGGGTGAGGGGCTGTGG + Intergenic