ID: 1024563493

View in Genome Browser
Species Human (GRCh38)
Location 7:50663434-50663456
Sequence TGGAGGGACTCGATGGTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 168}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024563493_1024563500 3 Left 1024563493 7:50663434-50663456 CCTCTCACCATCGAGTCCCTCCA 0: 1
1: 0
2: 1
3: 13
4: 168
Right 1024563500 7:50663460-50663482 GGGATGAGTGCCATGTGACTAGG 0: 1
1: 0
2: 1
3: 11
4: 134
1024563493_1024563505 25 Left 1024563493 7:50663434-50663456 CCTCTCACCATCGAGTCCCTCCA 0: 1
1: 0
2: 1
3: 13
4: 168
Right 1024563505 7:50663482-50663504 GGTCCTTCTCACAGGGATAATGG No data
1024563493_1024563504 18 Left 1024563493 7:50663434-50663456 CCTCTCACCATCGAGTCCCTCCA 0: 1
1: 0
2: 1
3: 13
4: 168
Right 1024563504 7:50663475-50663497 TGACTAGGGTCCTTCTCACAGGG 0: 1
1: 0
2: 2
3: 22
4: 218
1024563493_1024563501 4 Left 1024563493 7:50663434-50663456 CCTCTCACCATCGAGTCCCTCCA 0: 1
1: 0
2: 1
3: 13
4: 168
Right 1024563501 7:50663461-50663483 GGATGAGTGCCATGTGACTAGGG No data
1024563493_1024563503 17 Left 1024563493 7:50663434-50663456 CCTCTCACCATCGAGTCCCTCCA 0: 1
1: 0
2: 1
3: 13
4: 168
Right 1024563503 7:50663474-50663496 GTGACTAGGGTCCTTCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024563493 Original CRISPR TGGAGGGACTCGATGGTGAG AGG (reversed) Intronic
900278471 1:1849194-1849216 AGGAGAGACTCCATGGGGAGAGG + Intronic
901640808 1:10692186-10692208 TGGAGGGACTGGTTGGTGGATGG + Intronic
903820689 1:26100288-26100310 TGGGGGGAAACGATGGGGAGAGG - Intergenic
905279996 1:36842980-36843002 TGGAGGGGGTGGATGGTGGGGGG - Intronic
906147884 1:43570666-43570688 TGGTGGGAATTGATGGGGAGGGG - Intronic
906615606 1:47231154-47231176 TTGAGGGGTTCGTTGGTGAGTGG - Intronic
912571925 1:110631094-110631116 TGAAGTGACTCTAGGGTGAGGGG - Intronic
912823869 1:112887987-112888009 TGGAGTGTCTGGATGGGGAGAGG - Intergenic
913971399 1:143420776-143420798 TGGAGGGGCTGGGTCGTGAGTGG - Intergenic
914065776 1:144246389-144246411 TGGAGGGGCTGGGTCGTGAGTGG - Intergenic
914113375 1:144719965-144719987 TGGAGGGGCTGGGTCGTGAGTGG + Intergenic
916032270 1:160887786-160887808 TGGAGTGAGTTGGTGGTGAGGGG - Intergenic
918381426 1:183959605-183959627 TGGTGGGACATGATGGTGATTGG - Intronic
919836864 1:201580919-201580941 TGGATGGACACGATGGTAAAGGG + Intergenic
920864890 1:209743770-209743792 GAGAGGGACTTGTTGGTGAGGGG - Intergenic
1067145225 10:43689379-43689401 AGGAGGGACGCGAGGGTGAGGGG + Intergenic
1068233930 10:54207634-54207656 TGGAGGAACTCTCTGGTGGGAGG + Intronic
1068602301 10:58968707-58968729 TGGAGGTACTGGATAGTGGGGGG - Intergenic
1069635509 10:69922627-69922649 TGGAGGGACACTATGGGGTGTGG - Intronic
1071263604 10:83943593-83943615 TGGAGGGAGTCACTGGTTAGAGG - Intergenic
1074885430 10:117689306-117689328 AGGAGGGCCTCGAGGGTAAGGGG + Intergenic
1076610709 10:131724330-131724352 TGGAGGGGCGGGATGCTGAGTGG - Intergenic
1076718905 10:132384100-132384122 TGGAGGGCCTCGAGGGGGACTGG - Intergenic
1077591983 11:3499431-3499453 TGGAGGGACTGGATGAGCAGAGG + Intergenic
1079004831 11:16784173-16784195 TGGAGGGACTGGTTGATCAGTGG - Intronic
1085533602 11:77205574-77205596 TGCAGGCAGTCGATGGCGAGTGG - Exonic
1087699905 11:101424026-101424048 AGGAGGGACTCCATGTTGTGAGG - Intergenic
1088413016 11:109556388-109556410 TTTAGGGACTTGGTGGTGAGAGG - Intergenic
1089528284 11:119110860-119110882 TGGAGGAAATCCCTGGTGAGGGG + Exonic
1090759497 11:129823805-129823827 AGGAGGGACTCGATGCAGGGTGG - Intronic
1091645718 12:2270886-2270908 TGGAGGGGCTGGATGGTGGTGGG + Intronic
1092160221 12:6311741-6311763 TGGAGGGAGGCCATGGTGGGTGG - Intronic
1092242036 12:6841126-6841148 TGGAGGGCCTAGCTGGGGAGAGG + Intronic
1092999081 12:13978762-13978784 TGGAGGGCCATGATGGTGAGTGG - Intronic
1101812631 12:108120921-108120943 GGGATGGACAAGATGGTGAGAGG + Intergenic
1101862487 12:108494338-108494360 TGGAGGGATTCTATGAAGAGGGG - Intergenic
1103764275 12:123270481-123270503 GGGAAGGACTCGACGGGGAGAGG - Intronic
1104740474 12:131168474-131168496 AGGAGGGGCTGGATGGTGAGTGG + Intergenic
1105721100 13:23115343-23115365 TGCAAACACTCGATGGTGAGAGG - Intergenic
1108095427 13:46895705-46895727 AGGAGAGACACGACGGTGAGAGG + Exonic
1108676641 13:52742832-52742854 TGGAGGGAGTGAGTGGTGAGTGG + Intergenic
1110851060 13:80245462-80245484 TGGTGGGAATTGATGGTGGGGGG - Intergenic
1112184242 13:97112806-97112828 TGGAAGGATTCAATGCTGAGGGG - Intergenic
1115572220 14:34677349-34677371 TGTAGGGGCTGGATGGTGGGGGG + Intergenic
1115706733 14:36007020-36007042 AGCAGGGACTCTAGGGTGAGAGG + Intergenic
1118163901 14:63317323-63317345 TGGAGGGATTCAAGGGAGAGTGG - Intronic
1120710408 14:87787571-87787593 TGGCTTGACTGGATGGTGAGAGG - Intergenic
1122388393 14:101364230-101364252 TGGAGGCCCTCGAGGGTGTGCGG + Intergenic
1122915951 14:104859077-104859099 TGGAGGGTGGAGATGGTGAGTGG - Intergenic
1122915970 14:104859166-104859188 TGGAGGGTGGAGATGGTGAGTGG - Intergenic
1122916173 14:104860015-104860037 TGGAGGGTGGAGATGGTGAGTGG - Intergenic
1122916252 14:104860375-104860397 TGGAGGGTGGAGATGGTGAGTGG - Intergenic
1124443844 15:29710860-29710882 TGGAGAGACGCGCTGGTGACAGG + Exonic
1126570194 15:50142446-50142468 AGGAGGAAGTGGATGGTGAGTGG - Intronic
1127758238 15:62113453-62113475 TGGAGGGGTTTGCTGGTGAGAGG - Intergenic
1128877467 15:71214246-71214268 TGGAGGGACTGGAGGGAGTGGGG - Intronic
1129361530 15:75027650-75027672 TGGAGAGACTGGAGGGCGAGAGG - Intronic
1132653741 16:1032959-1032981 TGGATGGACTGGTGGGTGAGTGG - Intergenic
1134803933 16:17108840-17108862 TGGCTGGACTCGTTGGTGGGCGG - Exonic
1136414428 16:30095139-30095161 TGGAAGGACTAAAGGGTGAGAGG + Exonic
1136628823 16:31477499-31477521 TGGAAGGACCCCTTGGTGAGCGG - Exonic
1138217869 16:55221023-55221045 TTGAGGGACTGGAAGGTAAGTGG + Intergenic
1141903422 16:87007290-87007312 TGGAGGGTCTCTAGGGTGAGTGG - Intergenic
1142068056 16:88073986-88074008 TGGTTGGACTTGGTGGTGAGCGG + Intronic
1143572805 17:7771083-7771105 CGGAGGGAATCTAAGGTGAGAGG - Intronic
1144811042 17:17999120-17999142 CAGAGGGACTCGCTGCTGAGGGG - Intronic
1146886529 17:36474621-36474643 TGGAAGGAGGGGATGGTGAGTGG + Intergenic
1146975704 17:37109767-37109789 CAGAAGGACTGGATGGTGAGGGG - Intronic
1148167446 17:45493166-45493188 TGAAGGGACTGGCTGGTAAGTGG + Intergenic
1148568555 17:48647938-48647960 GGAAGGGACTGGATTGTGAGGGG - Intergenic
1150398629 17:64839581-64839603 TGAAGGGACTGGCTGGTAAGTGG + Intergenic
1155493805 18:26423878-26423900 TGGAAGGACTGGGTGGTGGGAGG + Intergenic
1158056560 18:53287126-53287148 GGGAGGGACTGGAAGATGAGAGG - Intronic
1160361851 18:78290090-78290112 TGGAGTGAAGTGATGGTGAGAGG - Intergenic
1160691794 19:463756-463778 TGGAGGGGCTAGAAGGCGAGAGG - Exonic
1160999938 19:1905511-1905533 TGGGGGGTCTCGGCGGTGAGGGG + Intronic
1163785626 19:19273435-19273457 ACGAGGGTGTCGATGGTGAGGGG - Intergenic
1164437824 19:28247374-28247396 GGCAGGGACTTGGTGGTGAGGGG - Intergenic
1166690552 19:44819558-44819580 TGCAGGGACAGGATGGAGAGAGG - Intronic
1167575250 19:50314814-50314836 TGGGGGGACTCGGGGGTGACCGG - Intronic
926052524 2:9753962-9753984 TGGAGGGGCTCTGTGGGGAGCGG + Intergenic
927277529 2:21274348-21274370 TGTAGGGACTAAAAGGTGAGAGG + Intergenic
927520305 2:23694355-23694377 AGGAAGGTCTCGATGGGGAGAGG - Intronic
927815077 2:26208531-26208553 TGGAGGGATACGGTGGGGAGGGG + Intronic
927996925 2:27493444-27493466 TGGAAGGTCTGGATGGAGAGCGG - Exonic
929268469 2:39945360-39945382 AGGAGGGAATAGATGATGAGAGG - Intergenic
929897716 2:45976276-45976298 TGGAGGGACTCGGGGGTCTGAGG - Intronic
930659854 2:54042674-54042696 TCAAGGGGCACGATGGTGAGGGG + Intronic
931138905 2:59435547-59435569 TGGAGGGAGTGAGTGGTGAGTGG + Intergenic
933565636 2:83947145-83947167 TGGAGAGACTCGATGGAGGCTGG - Intergenic
934176091 2:89581709-89581731 TGGAGGGGCTGGATCGTGAGTGG - Intergenic
934286401 2:91656071-91656093 TGGAGGGGCTGGATCGTGAGTGG - Intergenic
935934754 2:108169514-108169536 TGGAGGGATTCAATGCTTAGTGG + Intergenic
941405662 2:165084363-165084385 TGTAGGCACTAGATGGTGGGTGG + Intergenic
945189082 2:207167163-207167185 TGCAGAGCTTCGATGGTGAGAGG + Intronic
948371857 2:237494596-237494618 TGGGGGGTCTCCAGGGTGAGAGG + Intronic
948641714 2:239379438-239379460 TTGAGGGACTGGAGGGTGACAGG - Intronic
1168892439 20:1303659-1303681 TGGAGGGACTGGGGGCTGAGGGG - Intronic
1169973645 20:11299133-11299155 GGGAGGGACCTGGTGGTGAGAGG - Intergenic
1172099427 20:32476300-32476322 TGGAGGGAGACGAAGGGGAGGGG + Intronic
1174192169 20:48748363-48748385 GGGAGGGACTAGATGGTTTGGGG - Intronic
1175304517 20:57966661-57966683 TGGGGTGACTCCATGGTGAGTGG - Intergenic
1175676694 20:60952232-60952254 TGCAGGGATTCGAGGCTGAGAGG + Intergenic
1176803204 21:13453607-13453629 GGGAGGGATACGGTGGTGAGGGG + Intergenic
1177052517 21:16254616-16254638 TGGAGGGACTCATTGGTGGAAGG - Intergenic
1178621157 21:34177643-34177665 TGCAGGGAGTCCAGGGTGAGGGG + Intergenic
1180605627 22:17057018-17057040 TGCAGGGGCTCCCTGGTGAGGGG - Intergenic
1181776788 22:25165871-25165893 GGGAGGGACTGGGGGGTGAGAGG + Intronic
1182494379 22:30695615-30695637 TGGAGGGCCTCCATGGTTGGCGG + Intronic
1183697766 22:39432852-39432874 TGGAGGGAAATGAAGGTGAGAGG + Intronic
1184674355 22:46032364-46032386 CGGAGGGACCTGATGGTGGGAGG + Intergenic
1185184736 22:49392197-49392219 TGGAGAGACATGATGGGGAGGGG - Intergenic
1203293168 22_KI270736v1_random:15181-15203 TGGAGGGACTCTGAGGTGAGGGG + Intergenic
949548991 3:5096767-5096789 TGGAAGGAGTTGATGATGAGTGG + Intergenic
949934646 3:9107279-9107301 TGGAGGGGCTCACTGCTGAGTGG + Intronic
955022265 3:55132831-55132853 TGGAGGGACAGGGTGTTGAGGGG - Intergenic
955377503 3:58410575-58410597 GGAAAGGACTCGATGGTGTGTGG + Intronic
958144910 3:89612227-89612249 GGGAGGGAGGGGATGGTGAGAGG - Intergenic
960057592 3:113286293-113286315 TGGGGGGACTGGATTGTGAGTGG + Intronic
960971695 3:123144418-123144440 TGGAGGGACTGGGAGGTGAGGGG - Intronic
961670440 3:128524513-128524535 TGGAGGGACTCAGTGGGGAGGGG - Intergenic
961796836 3:129415215-129415237 TGGAGGCACAGGATGGGGAGGGG + Intronic
962852483 3:139318414-139318436 TGGAAGGGCTGGATGGGGAGGGG + Intronic
964262297 3:154853082-154853104 TAGAGGGAGAGGATGGTGAGGGG + Intergenic
964482941 3:157160247-157160269 TGGAGGGACTAGTTGGCGCGCGG - Intronic
965997432 3:174901716-174901738 TGGAGGTTATGGATGGTGAGTGG + Intronic
966443311 3:179972330-179972352 TGGAGGAAATAGATGGAGAGTGG - Intronic
968063378 3:195743975-195743997 TGTTGAGAATCGATGGTGAGAGG + Intergenic
970586261 4:17517326-17517348 TGGAGAGACACGAGGGAGAGGGG + Intronic
971334039 4:25706100-25706122 TGGAGGGGGCCGAGGGTGAGAGG - Intergenic
972671106 4:41214640-41214662 TGGAGGGACCCGGCGGGGAGGGG + Intronic
973497104 4:51241824-51241846 TGGAGGGATTCGTTGGAAAGGGG + Intergenic
977098374 4:92774837-92774859 TGGTGGGAGGCCATGGTGAGAGG - Intronic
984349353 4:178570622-178570644 GGAAGGGACTCAAGGGTGAGTGG - Intergenic
988203348 5:28098806-28098828 TGGAGGGCATGCATGGTGAGAGG - Intergenic
989010512 5:36866421-36866443 TGGTGGGAACCAATGGTGAGTGG + Intergenic
989259015 5:39398317-39398339 TGGAAGGATTCTAAGGTGAGTGG + Intronic
990327973 5:54696960-54696982 AGGAGGGGCTTGAGGGTGAGGGG - Intergenic
997055546 5:130438938-130438960 TGGAGAGATAAGATGGTGAGAGG - Intergenic
997338828 5:133126693-133126715 GGGTGGGACCCAATGGTGAGGGG + Intergenic
998783724 5:145686414-145686436 TGGTGGGGCTGGGTGGTGAGGGG - Intronic
999280126 5:150359581-150359603 TGGAGGGACTAAAGGGTGATGGG + Intronic
1003146750 6:3516418-3516440 TGGGGGGAGACGATGGGGAGCGG - Intergenic
1006876950 6:37305893-37305915 TGGAGGGAATTGGTGGGGAGTGG + Intronic
1009779871 6:68256083-68256105 TGGAGTGACCAGATGGGGAGGGG - Intergenic
1010076339 6:71803236-71803258 TGGAGAGAATCAATGGTGGGTGG + Intergenic
1011433362 6:87312027-87312049 GGGAGGGAGTGGATAGTGAGTGG + Intronic
1011686852 6:89830247-89830269 AGGAGAGACTGGATGGTGGGGGG - Intronic
1016990007 6:149922358-149922380 TGGTGGCAGTGGATGGTGAGGGG + Intronic
1016993046 6:149942705-149942727 TGGTGGCAGTGGATGGTGAGGGG - Intronic
1017005289 6:150024819-150024841 TGGTGGCAGTGGATGGTGAGGGG + Intronic
1017220668 6:151962044-151962066 AGGAGGGAGTGGATGTTGAGTGG + Intronic
1018044434 6:159953236-159953258 TGGAGGGACGCCAAGGTCAGTGG + Intergenic
1019282976 7:209930-209952 TGGAGGGACTCGACCGAGGGAGG + Intronic
1023101686 7:36724394-36724416 TGGAGGGAGTCTGTGGTGTGCGG + Exonic
1024563493 7:50663434-50663456 TGGAGGGACTCGATGGTGAGAGG - Intronic
1027223231 7:76227342-76227364 TGGAGGTGCTTGAGGGTGAGGGG - Intronic
1028883860 7:95910173-95910195 AGGAGGGACTCAATATTGAGTGG - Intronic
1030090176 7:105851338-105851360 TCGAGGAACTCGATGGTGCAGGG - Intronic
1032076144 7:128837125-128837147 TGGAGGGAGACGATGGTGAGGGG - Intronic
1032305736 7:130731857-130731879 TGGAGGGACTATATGGTCAGAGG + Exonic
1034457795 7:151180896-151180918 AGGAGGGCCACCATGGTGAGGGG - Intronic
1034997306 7:155586307-155586329 TGCAGGGACTCAGTGGTAAGAGG - Intergenic
1037548984 8:19951353-19951375 TGAAGGGAGGCGAAGGTGAGTGG + Intronic
1040318654 8:46277959-46277981 TGGAGGGCCTCCATGGACAGTGG - Intergenic
1045270567 8:100657658-100657680 TGGAGGGACAAGATGGGGATTGG + Intronic
1048570664 8:135652691-135652713 GGGAGGGCCTCCAGGGTGAGGGG - Intronic
1048911200 8:139136785-139136807 TGGAGTGACTTGAGGGTTAGAGG + Intergenic
1049924172 9:392872-392894 TGGAGAGACATGATGGTGGGTGG - Intronic
1052897111 9:33758011-33758033 AGGAGGGACTCGATGCAGGGTGG - Intronic
1053345146 9:37372556-37372578 TGGAGGGAATTGAGGGGGAGAGG - Intergenic
1054798438 9:69324702-69324724 TGGGGCGACTCGATGGGAAGAGG - Intronic
1054969088 9:71063575-71063597 TGGAGGGATTCAATAGTCAGAGG + Intronic
1057231426 9:93323922-93323944 TTGAGGGTCTCCATGGAGAGGGG - Intronic
1058828251 9:108793920-108793942 TGGTGGGAGGGGATGGTGAGTGG - Intergenic
1060063576 9:120483077-120483099 TGGAGGGGCTGGGTGGAGAGGGG - Intronic
1061277711 9:129579006-129579028 TGGAGAGAGTAGAGGGTGAGAGG - Intergenic
1061650385 9:132043391-132043413 TGGAGGAACTAGAAGGAGAGAGG + Intronic
1061967576 9:134025043-134025065 AGGAGGGGCTGGATGGTGAGGGG - Intergenic
1191900840 X:66039404-66039426 TGGATGGACTAGATGGTCTGGGG + Intronic
1192691993 X:73373985-73374007 CTGAGAGACTAGATGGTGAGTGG + Intergenic
1195128243 X:101829873-101829895 TGCAGGAACTCCAGGGTGAGTGG - Intergenic
1198038109 X:132821564-132821586 TGGAGGGCCTGGGTGGGGAGGGG - Intronic