ID: 1024563494

View in Genome Browser
Species Human (GRCh38)
Location 7:50663439-50663461
Sequence CACCATCGAGTCCCTCCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 153}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024563491_1024563494 -8 Left 1024563491 7:50663424-50663446 CCTGCCACAGCCTCTCACCATCG 0: 1
1: 0
2: 1
3: 36
4: 381
Right 1024563494 7:50663439-50663461 CACCATCGAGTCCCTCCACTTGG 0: 1
1: 0
2: 1
3: 7
4: 153
1024563485_1024563494 23 Left 1024563485 7:50663393-50663415 CCTTAACCACTTCCCATTTTCTC 0: 1
1: 0
2: 2
3: 41
4: 411
Right 1024563494 7:50663439-50663461 CACCATCGAGTCCCTCCACTTGG 0: 1
1: 0
2: 1
3: 7
4: 153
1024563488_1024563494 10 Left 1024563488 7:50663406-50663428 CCATTTTCTCCTTTGCCTCCTGC 0: 1
1: 1
2: 31
3: 318
4: 1881
Right 1024563494 7:50663439-50663461 CACCATCGAGTCCCTCCACTTGG 0: 1
1: 0
2: 1
3: 7
4: 153
1024563487_1024563494 11 Left 1024563487 7:50663405-50663427 CCCATTTTCTCCTTTGCCTCCTG 0: 1
1: 1
2: 9
3: 73
4: 805
Right 1024563494 7:50663439-50663461 CACCATCGAGTCCCTCCACTTGG 0: 1
1: 0
2: 1
3: 7
4: 153
1024563490_1024563494 -5 Left 1024563490 7:50663421-50663443 CCTCCTGCCACAGCCTCTCACCA 0: 1
1: 1
2: 28
3: 438
4: 6434
Right 1024563494 7:50663439-50663461 CACCATCGAGTCCCTCCACTTGG 0: 1
1: 0
2: 1
3: 7
4: 153
1024563486_1024563494 17 Left 1024563486 7:50663399-50663421 CCACTTCCCATTTTCTCCTTTGC 0: 1
1: 0
2: 10
3: 98
4: 863
Right 1024563494 7:50663439-50663461 CACCATCGAGTCCCTCCACTTGG 0: 1
1: 0
2: 1
3: 7
4: 153
1024563489_1024563494 1 Left 1024563489 7:50663415-50663437 CCTTTGCCTCCTGCCACAGCCTC 0: 1
1: 0
2: 35
3: 217
4: 1005
Right 1024563494 7:50663439-50663461 CACCATCGAGTCCCTCCACTTGG 0: 1
1: 0
2: 1
3: 7
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024563494 Original CRISPR CACCATCGAGTCCCTCCACT TGG Intronic
900152191 1:1183546-1183568 CTCCCTCGCGTCCCTCCACCTGG + Intronic
901925392 1:12562896-12562918 CAGCATCGTGTCCCTGCTCTAGG + Intergenic
904260435 1:29284665-29284687 GACCATCGAGCCCCTCCTGTAGG - Intronic
904285553 1:29451345-29451367 CACCATCAAGACCCTCCAGGAGG + Intergenic
906577865 1:46907020-46907042 CTCCAGCCAGTCCCTCCATTCGG - Intergenic
911497349 1:98647940-98647962 CACCATAGAGACTCCCCACTAGG - Intergenic
915349917 1:155217874-155217896 CACCATGGAGTTTCTCCCCTGGG - Intergenic
915817133 1:158980085-158980107 CTCCAGCCAGTCCCTCCATTTGG - Intergenic
918176044 1:182046214-182046236 CTCCAGCCAGTCCCTCCATTTGG + Intergenic
918461700 1:184783349-184783371 CGCCAGCCAGTCCCTCCATTTGG - Intergenic
921900403 1:220444114-220444136 CTCCAGCCAGTCCCTCCATTCGG - Intergenic
1065499614 10:26366615-26366637 CTCCAGCCAGTCCCTCCATTTGG - Intergenic
1068233926 10:54207629-54207651 CACCAGAGAGTTCCTCCACAGGG - Intronic
1069844569 10:71362164-71362186 CAACATCGAGTCCCTCAACAAGG + Exonic
1072053518 10:91729897-91729919 CATCATTGAGACCCTCCACTGGG + Intergenic
1075054855 10:119209659-119209681 CACAACCGTGTCCCACCACTAGG - Intronic
1075064941 10:119282934-119282956 GCCCATCCAGTCCCTCCTCTAGG + Intronic
1077594440 11:3519497-3519519 CTCCAGCCAGTCCCTCCATTTGG - Intergenic
1081328469 11:41775005-41775027 CTCCAGCCAGTCCCTCCATTCGG + Intergenic
1082299466 11:50488855-50488877 CTTCAGCCAGTCCCTCCACTTGG + Intergenic
1084642121 11:70432227-70432249 CCCCCTCTAGTCCCTCCCCTTGG + Intronic
1087680278 11:101212299-101212321 CTCCAACCAGTCCCTCCACTCGG + Intergenic
1089341644 11:117762036-117762058 CAGCATCGACTCACTCCACGCGG + Intronic
1089766571 11:120771880-120771902 CACCATGGAGAACCCCCACTTGG + Intronic
1091410414 12:235395-235417 CTCCAGCCAGTCCCTCCATTCGG - Intronic
1096798702 12:54095075-54095097 CACCAGCCACTCCCTCTACTTGG - Intergenic
1102982840 12:117256037-117256059 CACCATCGATTCTCCCCTCTAGG - Exonic
1104277965 12:127347443-127347465 CTCCAGCCAGTCCCTCCATTCGG + Intergenic
1105933052 13:25070124-25070146 CACCAGGGAGTCCCTCCGCAGGG - Intergenic
1108602216 13:52004784-52004806 CACCACAGAGTGCCCCCACTAGG - Intronic
1109682504 13:65771427-65771449 CTCCAGCCAGTCCCTCCATTCGG - Intergenic
1109963315 13:69659885-69659907 CTCCAGCCAGTCCCTCCATTTGG - Intergenic
1111452249 13:88434646-88434668 CTCCAGCTGGTCCCTCCACTCGG - Intergenic
1113761921 13:112854300-112854322 CACCATCGAGGCCCTGCAGAAGG + Exonic
1119800548 14:77441156-77441178 CAAAATCGAGTGCCTCCTCTAGG + Intronic
1120397052 14:83981362-83981384 CTCCAGCCAGTCCCTCCATTTGG - Intergenic
1122479723 14:102039233-102039255 CACCATGGAGTCCCTCAAGCAGG + Exonic
1122542862 14:102507706-102507728 CGCCAGCGAGGCCTTCCACTGGG - Exonic
1127092314 15:55479268-55479290 CTCCAGCCAGTCCCTCCATTCGG - Intronic
1127441402 15:59012678-59012700 AACCATCCAGTTGCTCCACTGGG - Intronic
1128516189 15:68343594-68343616 CACCAGCGACTACCTCCACCTGG - Intronic
1132737992 16:1396956-1396978 AGCCAGCGAGTCTCTCCACTTGG - Intronic
1133359324 16:5161343-5161365 CTCCAGCCAGTCCCTCCATTTGG - Intergenic
1139346151 16:66305167-66305189 CAACTTGGAGACCCTCCACTGGG - Intergenic
1142636369 17:1260204-1260226 GACCCCCGAGTCCCTCCCCTGGG + Intergenic
1142917636 17:3154795-3154817 CACCTTTGAGTTCCTCCTCTGGG - Intergenic
1143014667 17:3885345-3885367 CACCATCGAGTCCCACCACGTGG - Exonic
1151851658 17:76694181-76694203 CTCCAACGAGTCTCTCCACCCGG - Intronic
1151879930 17:76888797-76888819 CACCAACGCGGCCCTCCAGTGGG - Intronic
1160719847 19:592299-592321 CACCAGCCACTCCCTCCCCTGGG + Intronic
1162033688 19:7927928-7927950 CTCCCTCGAGACCCTCCCCTTGG + Intronic
1166332795 19:42088428-42088450 CCCCATCAAGTCCCACCACCTGG - Intronic
1167575252 19:50314819-50314841 CACCCCCGAGTCCCCCCACAGGG + Intronic
1167806449 19:51789584-51789606 CACCACAGAGTGCCTCCACTAGG - Intronic
1167960938 19:53103591-53103613 CGCCCCCGGGTCCCTCCACTTGG - Intergenic
1168650609 19:58089880-58089902 CATCAGCGAGGCCCTCCACCAGG + Exonic
925660566 2:6197970-6197992 CTCCAGCCAGTCCCTCCATTCGG - Intergenic
929054492 2:37863924-37863946 CACCATGTAATCCCTGCACTTGG + Intergenic
929350162 2:40941272-40941294 CTCCAGCCAGTCCCTCCATTCGG - Intergenic
932579725 2:72985389-72985411 CACCGTCCAGTCCCTGTACTTGG - Intronic
933318845 2:80746745-80746767 TACTATCGAGTCCCTCCGTTAGG - Intergenic
935971924 2:108537844-108537866 GACCTTGGAGCCCCTCCACTGGG + Intronic
936525385 2:113237700-113237722 CACCATGGCCTCCTTCCACTGGG + Intronic
937069930 2:119055543-119055565 CTCCAGCCAGTCCCTCCATTCGG + Intergenic
937980538 2:127612100-127612122 CACCATGCAGTCCCTCAGCTTGG - Intronic
940276090 2:151942239-151942261 CTCCAGCCAGTCCCTCCATTTGG - Intronic
941289462 2:163657646-163657668 CAGCAACGAGTTCTTCCACTTGG + Intronic
942108639 2:172658236-172658258 CTCCAGCCAGTCCCTCCATTCGG - Intergenic
942564946 2:177256938-177256960 CACCATCAAGTCTCTCAAGTGGG + Intronic
944174860 2:196818157-196818179 CTCCAGCCAGTCCCTCCATTCGG + Intergenic
944878086 2:203983374-203983396 CACCCTCTAGTCCCTGCCCTGGG + Intergenic
948339817 2:237240527-237240549 CTCCAGCCAGTCCCTCCATTTGG - Intergenic
1171797716 20:29579269-29579291 CACCAGCCACTCCCTCTACTTGG + Intergenic
1171850531 20:30304892-30304914 CACCAGCCACTCCCTCTACTTGG - Intergenic
1175093206 20:56521611-56521633 CTTCATCCAGTCCCTCCATTTGG + Intronic
1177085240 21:16694977-16694999 CCTCATGGAGACCCTCCACTAGG - Intergenic
1179137791 21:38695919-38695941 CAACCTTGAGTCCCTCCTCTTGG - Intergenic
1180990778 22:19934459-19934481 CTCCAGCCAGTCCCTCCATTCGG - Intronic
1181536177 22:23546922-23546944 CACCAGCTGGTCCCTCCATTCGG - Intergenic
1183370609 22:37429683-37429705 CACCATCTAGACACTCGACTGGG + Intergenic
1183377737 22:37474741-37474763 CCCCATGAAGGCCCTCCACTGGG + Intronic
949217469 3:1586983-1587005 CTCCAGCCAGTCCCTCCATTCGG - Intergenic
949231388 3:1754988-1755010 CTCCAGCCAGTCCCTCCATTCGG + Intergenic
950819143 3:15739392-15739414 CTTCAGCCAGTCCCTCCACTTGG + Intronic
951459335 3:22932469-22932491 CTCCAACAAGACCCTCCACTAGG + Intergenic
952138033 3:30445811-30445833 CACCCTCATGTCCCTCCACATGG - Intergenic
952687056 3:36162219-36162241 CTCCATGAAGTCCCTCCAATGGG + Intergenic
957064576 3:75510867-75510889 CTCCAGCCAGTCCCTCCATTTGG - Intergenic
958193905 3:90218575-90218597 CTCCATCCAGTTCCTCCATTTGG - Intergenic
958417262 3:93889633-93889655 CTCCATCCAGTCCCTCCATTCGG - Intronic
959220106 3:103507378-103507400 CTCCAGCCAGTCCCTCCATTCGG + Intergenic
961288777 3:125828534-125828556 CTCCAGCCAGTCCCTCCATTTGG + Intergenic
961515395 3:127429618-127429640 CACCCTCAAATCCATCCACTTGG - Intergenic
961539221 3:127589173-127589195 CAGCATCCTGTCCCTCAACTGGG - Intronic
964180300 3:153875285-153875307 CTCCAGCCAGTCCCTCCATTTGG + Intergenic
967996917 3:195173806-195173828 CACCAGGGAGTCCCTCCTATGGG + Intronic
969804492 4:9596437-9596459 CTCCAGCCAGTCCCTCCATTTGG + Intergenic
972362439 4:38339683-38339705 CTCCAGCCAGTCCCTCCATTCGG + Intergenic
975006668 4:69297020-69297042 CTCCACCCAGTCCCTCCATTCGG + Intronic
975016350 4:69425417-69425439 CTCCAGCCAGTCCCTCCATTCGG + Intergenic
975307741 4:72868280-72868302 CTCCAGCCAGTCCCTCCATTCGG + Intergenic
976741870 4:88364984-88365006 CTCCAGCGGGTCCCTCCATTCGG + Intergenic
977316786 4:95460115-95460137 TACCAGCAAGTACCTCCACTGGG + Intronic
979400661 4:120245667-120245689 CTCCAGCCAGTCCCTCCATTCGG + Intergenic
984431902 4:179661039-179661061 CACCACAGAGAGCCTCCACTAGG + Intergenic
985504744 5:272201-272223 CACCCTGGAGACCCTCCACCTGG - Intronic
985743370 5:1633395-1633417 CACCCTGGAGACCCTCCACCTGG + Intergenic
990154259 5:52856868-52856890 CATCATCTGGTCCCTCAACTGGG + Intronic
991321953 5:65383773-65383795 CACCATAGAGGGCCCCCACTAGG - Intronic
992128418 5:73666439-73666461 CACCAAAGAGAGCCTCCACTAGG - Intronic
993533294 5:89049774-89049796 CTCCAGCCAGTCCCTCCATTTGG - Intergenic
995422648 5:111984295-111984317 CACCACCTACTCCCTCCCCTTGG - Intronic
996097416 5:119413566-119413588 CTCCAGCCAGTCCCTCCATTCGG - Intergenic
999375304 5:151082369-151082391 CACCACTGAGTCTCACCACTGGG + Intronic
1000880681 5:166693572-166693594 CTCCAGCCAGTCCCTCCATTTGG + Intergenic
1001870091 5:175146423-175146445 CTCCAGCCAGTCCCTCCATTTGG - Intergenic
1002782813 6:380035-380057 CAGCATCCAGTCCTTCCACTGGG + Intergenic
1004086496 6:12454540-12454562 CTCCAGCCAGTCCCTCCATTTGG + Intergenic
1005997570 6:30940720-30940742 CACCCTCACTTCCCTCCACTGGG + Intergenic
1009995087 6:70888149-70888171 CAGCCTCGACACCCTCCACTGGG + Intronic
1010796587 6:80123413-80123435 CTCCAGCCAGTCCCTCCATTTGG + Intronic
1011433360 6:87312022-87312044 CACTATCCACTCCCTCCCCTGGG - Intronic
1011570117 6:88725795-88725817 CTCCAGCCAGTCCCTCCCCTAGG + Intronic
1014239428 6:118998669-118998691 CACCTACCAGTCCCTCCACATGG - Intronic
1016855435 6:148665724-148665746 CTCCATCTGGTCCCTCCATTCGG - Intergenic
1017155939 6:151322708-151322730 CACCACCCACTCCCGCCACTGGG + Intronic
1017309253 6:152957180-152957202 CACCGTCGAGAGCCCCCACTAGG + Intergenic
1019072149 6:169355751-169355773 CTCCAGCCAGTCCCTCCATTCGG + Intergenic
1019133024 6:169891115-169891137 CCTCATCCAGTCCCTCCTCTAGG - Intergenic
1020546624 7:9541077-9541099 CATCATGGAGACCCTCTACTAGG + Intergenic
1022525620 7:31035188-31035210 CAGCTCCCAGTCCCTCCACTGGG - Intergenic
1024007560 7:45238292-45238314 CACCAAGGAGTCCCTCCATGAGG + Intergenic
1024563494 7:50663439-50663461 CACCATCGAGTCCCTCCACTTGG + Intronic
1031668925 7:124519130-124519152 CCCCATGGAGAACCTCCACTAGG + Intergenic
1032003343 7:128281117-128281139 CTCCAGCCAGTCCCTCCATTCGG + Intergenic
1034279074 7:149838898-149838920 CACCTTCGCATCGCTCCACTCGG - Intronic
1036118474 8:5987579-5987601 CTCCAGCCAGTCCCTCTACTCGG + Intergenic
1036768570 8:11564033-11564055 CACCTTCGAGTTCCTGCAGTCGG + Exonic
1037943919 8:22974686-22974708 GGCCATCAAGCCCCTCCACTGGG + Intronic
1041985950 8:63922688-63922710 GACCGTTGAGTACCTCCACTTGG - Intergenic
1044182253 8:89210596-89210618 CTCCAGCCAGTCCCTCCATTCGG - Intergenic
1046585521 8:116145850-116145872 AACGTTTGAGTCCCTCCACTAGG - Intergenic
1046681611 8:117176934-117176956 CACCATCTTCTTCCTCCACTGGG - Intergenic
1047554369 8:125913061-125913083 GACCATAGAGTCCCTAGACTTGG - Intergenic
1051213498 9:14771102-14771124 CGCCATGGATTCCCTGCACTTGG + Intronic
1052687092 9:31770558-31770580 CTCCAGCCAGTCCCTCCATTCGG - Intergenic
1052802297 9:32980358-32980380 CACCATCTTGTCCATCTACTTGG + Intronic
1053788312 9:41668183-41668205 CACCAGCCACTCCCTCTACTTGG - Intergenic
1054156829 9:61646585-61646607 CACCAGCCACTCCCTCTACTTGG + Intergenic
1054176594 9:61879522-61879544 CACCAGCCACTCCCTCTACTTGG - Intergenic
1054660941 9:67701284-67701306 CACCAGCCACTCCCTCTACTTGG + Intergenic
1055846003 9:80564175-80564197 GACCATCTTCTCCCTCCACTTGG - Intergenic
1058143715 9:101385957-101385979 CTCCAGCCAGTCCCTCCATTTGG + Intergenic
1058952035 9:109913048-109913070 CAACATCCAGCTCCTCCACTGGG - Intronic
1062402773 9:136379686-136379708 CTCCCTCGAGTCCCACCACAGGG - Intronic
1187634329 X:21210569-21210591 CAGCATTGAGTCCCTGCTCTAGG + Intergenic
1189497359 X:41521103-41521125 CACCAACAAGTCCCTGCCCTTGG + Intronic
1191191677 X:57674877-57674899 CTCCAGCCAGTCCCTCCATTTGG + Intergenic
1193300787 X:79886333-79886355 CTCCATCTGGTCCCTCCATTTGG + Intergenic
1199007449 X:142718447-142718469 CTCCATCTGGTCCCTCCATTCGG + Intergenic
1199891262 X:152084546-152084568 CAGTATCCAGTCCCTCCACTGGG - Intergenic
1201616800 Y:15909470-15909492 CTCCAGCTAGTCCCTCCATTTGG + Intergenic