ID: 1024563495

View in Genome Browser
Species Human (GRCh38)
Location 7:50663440-50663462
Sequence ACCATCGAGTCCCTCCACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 84}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024563489_1024563495 2 Left 1024563489 7:50663415-50663437 CCTTTGCCTCCTGCCACAGCCTC 0: 1
1: 0
2: 35
3: 217
4: 1005
Right 1024563495 7:50663440-50663462 ACCATCGAGTCCCTCCACTTGGG 0: 1
1: 0
2: 0
3: 3
4: 84
1024563487_1024563495 12 Left 1024563487 7:50663405-50663427 CCCATTTTCTCCTTTGCCTCCTG 0: 1
1: 1
2: 9
3: 73
4: 805
Right 1024563495 7:50663440-50663462 ACCATCGAGTCCCTCCACTTGGG 0: 1
1: 0
2: 0
3: 3
4: 84
1024563486_1024563495 18 Left 1024563486 7:50663399-50663421 CCACTTCCCATTTTCTCCTTTGC 0: 1
1: 0
2: 10
3: 98
4: 863
Right 1024563495 7:50663440-50663462 ACCATCGAGTCCCTCCACTTGGG 0: 1
1: 0
2: 0
3: 3
4: 84
1024563491_1024563495 -7 Left 1024563491 7:50663424-50663446 CCTGCCACAGCCTCTCACCATCG 0: 1
1: 0
2: 1
3: 36
4: 381
Right 1024563495 7:50663440-50663462 ACCATCGAGTCCCTCCACTTGGG 0: 1
1: 0
2: 0
3: 3
4: 84
1024563485_1024563495 24 Left 1024563485 7:50663393-50663415 CCTTAACCACTTCCCATTTTCTC 0: 1
1: 0
2: 2
3: 41
4: 411
Right 1024563495 7:50663440-50663462 ACCATCGAGTCCCTCCACTTGGG 0: 1
1: 0
2: 0
3: 3
4: 84
1024563488_1024563495 11 Left 1024563488 7:50663406-50663428 CCATTTTCTCCTTTGCCTCCTGC 0: 1
1: 1
2: 31
3: 318
4: 1881
Right 1024563495 7:50663440-50663462 ACCATCGAGTCCCTCCACTTGGG 0: 1
1: 0
2: 0
3: 3
4: 84
1024563490_1024563495 -4 Left 1024563490 7:50663421-50663443 CCTCCTGCCACAGCCTCTCACCA 0: 1
1: 1
2: 28
3: 438
4: 6434
Right 1024563495 7:50663440-50663462 ACCATCGAGTCCCTCCACTTGGG 0: 1
1: 0
2: 0
3: 3
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024563495 Original CRISPR ACCATCGAGTCCCTCCACTT GGG Intronic
902274699 1:15331030-15331052 ACCATCCAGTCCTACCACTGAGG - Intronic
903163751 1:21507175-21507197 GCCCTCAAGTCCCTCCACCTCGG - Intergenic
909894631 1:81052059-81052081 TCCATCTAGTCCTGCCACTTTGG + Intergenic
912527704 1:110296867-110296889 ACCATCAAGTCCCTAGAGTTCGG - Intergenic
915817132 1:158980084-158980106 TCCAGCCAGTCCCTCCATTTGGG - Intergenic
918176045 1:182046215-182046237 TCCAGCCAGTCCCTCCATTTGGG + Intergenic
918461699 1:184783348-184783370 GCCAGCCAGTCCCTCCATTTGGG - Intergenic
919300483 1:195757182-195757204 ACCATCTCTTCCCTACACTTTGG + Intergenic
922998922 1:229989618-229989640 ACCATTGAGTCTCCCTACTTAGG + Intergenic
1065499613 10:26366614-26366636 TCCAGCCAGTCCCTCCATTTGGG - Intergenic
1069844570 10:71362165-71362187 AACATCGAGTCCCTCAACAAGGG + Exonic
1071263605 10:83943599-83943621 ACCAGTGACTCCCTCCACTGTGG + Intergenic
1071594041 10:86905231-86905253 ACCATGGCCTCCCTCCACTGTGG + Intronic
1077594439 11:3519496-3519518 TCCAGCCAGTCCCTCCATTTGGG - Intergenic
1081070864 11:38606881-38606903 ACCATTGACTTCCACCACTTTGG + Intergenic
1082299467 11:50488856-50488878 TTCAGCCAGTCCCTCCACTTGGG + Intergenic
1087013783 11:93537303-93537325 GCATTTGAGTCCCTCCACTTCGG + Intronic
1087034740 11:93743851-93743873 GCCATCGACTCCCACCAATTAGG + Intronic
1087680279 11:101212300-101212322 TCCAACCAGTCCCTCCACTCGGG + Intergenic
1089766572 11:120771881-120771903 ACCATGGAGAACCCCCACTTGGG + Intronic
1108476429 13:50823191-50823213 ACCATCAAGTCTTTCCCCTTTGG + Intronic
1109963314 13:69659884-69659906 TCCAGCCAGTCCCTCCATTTGGG - Intergenic
1118525236 14:66632925-66632947 ACCATCCATTCCATCCAGTTTGG + Intronic
1120397051 14:83981361-83981383 TCCAGCCAGTCCCTCCATTTGGG - Intergenic
1121382015 14:93479891-93479913 ACCATCGCCTCCCAGCACTTTGG - Intronic
1124146079 15:27126655-27126677 ACCATGGATTTGCTCCACTTTGG - Intronic
1125363308 15:38887529-38887551 ACCATCAAGTCCCCCAACCTTGG - Intergenic
1129540443 15:76343233-76343255 ACCCCCGACCCCCTCCACTTCGG - Intergenic
1132024761 15:98395609-98395631 ACCATGGGGCCCCTCCACCTTGG + Intergenic
1132940605 16:2505862-2505884 ACCAGCGAGTCTCTCCACTGAGG + Intronic
1133359323 16:5161342-5161364 TCCAGCCAGTCCCTCCATTTGGG - Intergenic
1137653509 16:50140509-50140531 AGCATCGCATCCCTCCTCTTGGG + Intergenic
1142636370 17:1260205-1260227 ACCCCCGAGTCCCTCCCCTGGGG + Intergenic
1143845973 17:9772852-9772874 AACATCGTATTCCTCCACTTCGG + Exonic
1158739531 18:60124089-60124111 ACCATCAAGTCCCTAGAGTTCGG + Intergenic
1165530948 19:36400883-36400905 CTCATCAAGTCACTCCACTTGGG + Intronic
1166332793 19:42088427-42088449 CCCATCAAGTCCCACCACCTGGG - Intronic
1167806448 19:51789583-51789605 ACCACAGAGTGCCTCCACTAGGG - Intronic
931292905 2:60892069-60892091 AACATTGAGTCGCTCTACTTAGG - Intronic
940276089 2:151942238-151942260 TCCAGCCAGTCCCTCCATTTGGG - Intronic
948339816 2:237240526-237240548 TCCAGCCAGTCCCTCCATTTGGG - Intergenic
1175093207 20:56521612-56521634 TTCATCCAGTCCCTCCATTTGGG + Intronic
1179012247 21:37564752-37564774 ACCACCGAGTGCCTCCAGTTAGG + Intergenic
1179137790 21:38695918-38695940 AACCTTGAGTCCCTCCTCTTGGG - Intergenic
1179658877 21:42862291-42862313 AGCATCGAGTCCTTCTGCTTGGG - Exonic
950819144 3:15739393-15739415 TTCAGCCAGTCCCTCCACTTGGG + Intronic
957064575 3:75510866-75510888 TCCAGCCAGTCCCTCCATTTGGG - Intergenic
957090676 3:75727022-75727044 TCCAGCCAGTCCCTCCATTTGGG - Intronic
958193904 3:90218574-90218596 TCCATCCAGTTCCTCCATTTGGG - Intergenic
958417261 3:93889632-93889654 TCCATCCAGTCCCTCCATTCGGG - Intronic
961288778 3:125828535-125828557 TCCAGCCAGTCCCTCCATTTGGG + Intergenic
962706299 3:138048103-138048125 CCTATCAAGTCCTTCCACTTAGG - Intergenic
963257921 3:143164353-143164375 ACCAGCAAGTGCCTACACTTAGG - Intergenic
964180301 3:153875286-153875308 TCCAGCCAGTCCCTCCATTTGGG + Intergenic
967658834 3:192080267-192080289 ATCATCTATTCCCTCCTCTTAGG + Intergenic
969804493 4:9596438-9596460 TCCAGCCAGTCCCTCCATTTGGG + Intergenic
971819219 4:31530322-31530344 ACCAGGGAGGGCCTCCACTTTGG - Intergenic
979395901 4:120188792-120188814 CCCATCCAGTCCCTTGACTTTGG - Intergenic
981424617 4:144588746-144588768 TCCAGCCAGTCCCTCCATTTGGG + Intergenic
981714294 4:147737634-147737656 ACCATAGAGCCCCTACAATTTGG + Intronic
983190883 4:164752262-164752284 TCCAGCCAGTCCCTCCATTTGGG - Intergenic
984194558 4:176642832-176642854 ACCAAGTAGCCCCTCCACTTTGG + Intergenic
991262803 5:64685219-64685241 CCCAGCGAGTCCATCCTCTTAGG + Intergenic
993533293 5:89049773-89049795 TCCAGCCAGTCCCTCCATTTGGG - Intergenic
995422647 5:111984294-111984316 ACCACCTACTCCCTCCCCTTGGG - Intronic
1000880682 5:166693573-166693595 TCCAGCCAGTCCCTCCATTTGGG + Intergenic
1001870090 5:175146422-175146444 TCCAGCCAGTCCCTCCATTTGGG - Intergenic
1002782814 6:380036-380058 AGCATCCAGTCCTTCCACTGGGG + Intergenic
1004086497 6:12454541-12454563 TCCAGCCAGTCCCTCCATTTGGG + Intergenic
1004622408 6:17342648-17342670 ACCATTGAGTGCCAGCACTTGGG - Intergenic
1007214452 6:40226615-40226637 ACCACAGACTTCCTCCACTTAGG + Intergenic
1010796588 6:80123414-80123436 TCCAGCCAGTCCCTCCATTTGGG + Intronic
1017031336 6:150225490-150225512 ACCTGTGAGTCCCTCTACTTCGG + Intronic
1024563495 7:50663440-50663462 ACCATCGAGTCCCTCCACTTGGG + Intronic
1026313542 7:69208879-69208901 ACCGTCCAGTCCATCTACTTGGG - Intergenic
1027630594 7:80600135-80600157 ACCATTGACTCCCTCCATTTAGG - Intronic
1040864320 8:52032856-52032878 GCCAGTGAGTCCCTCCACCTAGG - Intergenic
1048493817 8:134919146-134919168 GCCATGCATTCCCTCCACTTGGG - Intergenic
1058143716 9:101385958-101385980 TCCAGCCAGTCCCTCCATTTGGG + Intergenic
1062266056 9:135687106-135687128 ACCATTGAGTACATCCACTGTGG + Intergenic
1191191678 X:57674878-57674900 TCCAGCCAGTCCCTCCATTTGGG + Intergenic
1192938724 X:75889858-75889880 ACCATCAAGTCCCTAGAGTTTGG - Intergenic
1193300788 X:79886334-79886356 TCCATCTGGTCCCTCCATTTGGG + Intergenic
1195200480 X:102545730-102545752 ACCATCAAGTCCCTAGAGTTTGG + Intergenic
1196241477 X:113347314-113347336 ACCATCAAGTCTTTCCCCTTTGG + Intergenic
1196508768 X:116480235-116480257 ATCATTTAGTCCCTCTACTTAGG - Intergenic
1198658848 X:138944391-138944413 ACCATCTACTGCCTTCACTTTGG + Intronic
1201616801 Y:15909471-15909493 TCCAGCTAGTCCCTCCATTTGGG + Intergenic