ID: 1024563496

View in Genome Browser
Species Human (GRCh38)
Location 7:50663441-50663463
Sequence TCCCAAGTGGAGGGACTCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 122}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024563496_1024563505 18 Left 1024563496 7:50663441-50663463 CCATCGAGTCCCTCCACTTGGGA 0: 1
1: 0
2: 0
3: 4
4: 122
Right 1024563505 7:50663482-50663504 GGTCCTTCTCACAGGGATAATGG No data
1024563496_1024563500 -4 Left 1024563496 7:50663441-50663463 CCATCGAGTCCCTCCACTTGGGA 0: 1
1: 0
2: 0
3: 4
4: 122
Right 1024563500 7:50663460-50663482 GGGATGAGTGCCATGTGACTAGG 0: 1
1: 0
2: 1
3: 11
4: 134
1024563496_1024563504 11 Left 1024563496 7:50663441-50663463 CCATCGAGTCCCTCCACTTGGGA 0: 1
1: 0
2: 0
3: 4
4: 122
Right 1024563504 7:50663475-50663497 TGACTAGGGTCCTTCTCACAGGG 0: 1
1: 0
2: 2
3: 22
4: 218
1024563496_1024563503 10 Left 1024563496 7:50663441-50663463 CCATCGAGTCCCTCCACTTGGGA 0: 1
1: 0
2: 0
3: 4
4: 122
Right 1024563503 7:50663474-50663496 GTGACTAGGGTCCTTCTCACAGG No data
1024563496_1024563501 -3 Left 1024563496 7:50663441-50663463 CCATCGAGTCCCTCCACTTGGGA 0: 1
1: 0
2: 0
3: 4
4: 122
Right 1024563501 7:50663461-50663483 GGATGAGTGCCATGTGACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024563496 Original CRISPR TCCCAAGTGGAGGGACTCGA TGG (reversed) Intronic
900152192 1:1183548-1183570 CGCCAGGTGGAGGGACGCGAGGG - Intronic
901068027 1:6503899-6503921 TCCCAAGGGGAGGGACCAGCAGG + Intronic
901086742 1:6615218-6615240 TGCCAAGTGGAGGGCGGCGACGG - Intronic
902371046 1:16006994-16007016 TACCACGTGGGGAGACTCGAGGG + Exonic
903163750 1:21507174-21507196 CCCGAGGTGGAGGGACTTGAGGG + Intergenic
907943400 1:59110274-59110296 TCCCAGGTGGAGGGACCAGTGGG - Intergenic
909013428 1:70358460-70358482 TCCCAAGTGCTGGGACTACAGGG + Intronic
915817131 1:158980083-158980105 CCCCAAATGGAGGGACTGGCTGG + Intergenic
917110031 1:171538260-171538282 TCCCAAGTGGCTGCACACGATGG - Intronic
918176046 1:182046216-182046238 CCCCAAATGGAGGGACTGGCTGG - Intergenic
918461698 1:184783347-184783369 CCCCAAATGGAGGGACTGGCTGG + Intergenic
920660978 1:207914079-207914101 TGCCAAGAGGAGGCACTGGAGGG - Intergenic
1065499612 10:26366613-26366635 CCCCAAATGGAGGGACTGGCTGG + Intergenic
1075687838 10:124376530-124376552 ACCCGAGTGGAGGGGCTCTAAGG - Intergenic
1076370432 10:129949485-129949507 TTCCAAGTGATGGGACTCGTGGG + Intronic
1077594438 11:3519495-3519517 CCCCAAATGGAGGGACTGGCTGG + Intergenic
1083201383 11:61123062-61123084 TCCCACGTGCAGAGACTGGAGGG + Intronic
1084642123 11:70432229-70432251 TGCCAAGGGGAGGGACTAGAGGG - Intronic
1087680280 11:101212301-101212323 CCCCGAGTGGAGGGACTGGTTGG - Intergenic
1091078699 11:132645256-132645278 TCCCAAGGGAAAGGACTTGAAGG + Intronic
1091262666 11:134246350-134246372 TACCAAGTGGAGCGACGTGAAGG - Exonic
1096252053 12:50039804-50039826 TCGCAAGTGCAGGGAATGGATGG + Intergenic
1100761461 12:97811819-97811841 TCCTAAGTGGAGGGAAGGGAAGG + Intergenic
1101589319 12:106112098-106112120 TCCCAAAAGGAGGGACTGGAGGG + Intronic
1105420918 13:20251614-20251636 TCCCAAGTGGTGGTTCTCAAAGG - Intergenic
1105731310 13:23219957-23219979 TCCCAAGTAGTGGGACTGCAAGG + Intronic
1109963313 13:69659883-69659905 CCCCAAATGGAGGGACTGGCTGG + Intergenic
1118822456 14:69354165-69354187 TCCCCAGAGGATGGACTAGAAGG + Exonic
1120397050 14:83981360-83981382 CCCCAAATGGAGGGACTGGCTGG + Intergenic
1128106338 15:65048051-65048073 TCCCAAGTAGTGGGACTACAGGG - Intronic
1128459747 15:67857899-67857921 TCCCAAGTGCTGGGATTCCAGGG - Intergenic
1129003117 15:72350380-72350402 TCCCAGGTGGAAGAAGTCGATGG + Intronic
1129937181 15:79460452-79460474 GCCCAAGAGGAGGGACCAGAGGG - Intronic
1130102661 15:80905765-80905787 TCACTAGTGGAGGGAGTCCAGGG + Intronic
1132737991 16:1396954-1396976 GGCCAAGTGGAGAGACTCGCTGG + Intronic
1133359322 16:5161341-5161363 CCCCAAATGGAGGGACTGGCTGG + Intergenic
1136033421 16:27519988-27520010 TCCCAAGTAGTGGGACTACAGGG - Intronic
1138375007 16:56557311-56557333 TCCCAAGTGGAGGGAGCTCATGG - Intergenic
1142636371 17:1260206-1260228 GCCCCAGGGGAGGGACTCGGGGG - Intergenic
1142917634 17:3154793-3154815 TCCCCAGAGGAGGAACTCAAAGG + Intergenic
1143014666 17:3885343-3885365 GGCCACGTGGTGGGACTCGATGG + Exonic
1144468079 17:15512878-15512900 TCCCAAGCAGGGGGACTCCATGG - Intronic
1148388443 17:47253486-47253508 TCCCAGGAGGCGGGACTGGAAGG + Intergenic
1149636792 17:58177313-58177335 TCCCAAGTTGAGGGACAAGGTGG + Intergenic
1162033689 19:7927930-7927952 GTCCAAGGGGAGGGTCTCGAGGG - Intronic
1166332792 19:42088426-42088448 TCCCAGGTGGTGGGACTTGATGG + Intronic
1167105805 19:47429489-47429511 ACCCGAGTGGAGGGATTGGAAGG + Exonic
1167289914 19:48618923-48618945 GACCAAGTGGAGGTACTCGGAGG - Intronic
1167960937 19:53103589-53103611 GACCAAGTGGAGGGACCCGGGGG + Intergenic
926008426 2:9390311-9390333 TCCCCAGGGGAGGAGCTCGAAGG + Intronic
935186915 2:100743005-100743027 TCCCACGTGGTGTGACTTGATGG + Intergenic
936271930 2:111055577-111055599 TCTCAAGTGGAGGCACTCAGGGG + Intronic
937069932 2:119055545-119055567 TCCCGAATGGAGGGACTGGCTGG - Intergenic
937525821 2:122768744-122768766 TCCAAAGTTGAGGAACTTGAAGG + Intergenic
940276088 2:151942237-151942259 CCCCAAATGGAGGGACTGGCTGG + Intronic
940386459 2:153079136-153079158 TCCCAAGTGGAGGGGCATGGAGG + Intergenic
942972899 2:181978622-181978644 TCCTAGCTGGAGGGACTGGAGGG + Intronic
948339815 2:237240525-237240547 CCCCAAATGGAGGGACTGGCTGG + Intergenic
948508831 2:238449367-238449389 TCCCTAGGAGAGGGGCTCGATGG + Exonic
1172837927 20:37884941-37884963 TCACTCGTGGAGGGACTGGAGGG - Intergenic
1175830836 20:61964989-61965011 TCCCAGGAGGAGGGACTGCAGGG - Intronic
1179012248 21:37564753-37564775 TCCTAACTGGAGGCACTCGGTGG - Intergenic
1179469658 21:41602124-41602146 TCCCAAGGGGAGGGACAGAAGGG - Intergenic
1180026182 21:45163572-45163594 TCCCCAGTGGGGGGCCTTGAGGG - Intronic
1180331964 22:11489478-11489500 TCCCGAATGGAGGGACTGGTGGG - Intergenic
1183784500 22:40021670-40021692 TCCCAAGGGGATGGGCTCCACGG - Exonic
1184272432 22:43392463-43392485 TCCCAGGGAGAGGGACTTGATGG + Intergenic
1184669276 22:46004311-46004333 TCCCAGGTAGAGGGGCTGGAGGG + Intergenic
949217467 3:1586981-1587003 TCCCGAATGGAGGGACTGGCTGG + Intergenic
951459337 3:22932471-22932493 TCCCTAGTGGAGGGTCTTGTTGG - Intergenic
954996430 3:54885978-54886000 TCCCAAGAGTAGGGTCACGACGG + Intronic
955385468 3:58475912-58475934 TCCCAAGTGCTGGGATTAGAGGG + Intergenic
957064574 3:75510865-75510887 CCCCAAATGGAGGGACTGGCTGG + Intergenic
957090675 3:75727021-75727043 CCCCAAATGGAGGGACTGGCTGG + Intronic
958193903 3:90218573-90218595 CCCCAAATGGAGGAACTGGATGG + Intergenic
958417260 3:93889631-93889653 CCCCGAATGGAGGGACTGGATGG + Intronic
961288779 3:125828536-125828558 CCCCAAATGGAGGGACTGGCTGG - Intergenic
964180302 3:153875287-153875309 CCCCAAATGGAGGGACTGGCTGG - Intergenic
967402566 3:189080305-189080327 CCTCAACTGGAGGGACTGGAGGG + Intronic
968881909 4:3305279-3305301 ACCCCAGTGGAGGGACTGCAGGG + Intronic
969804494 4:9596439-9596461 CCCCAAATGGAGGGACTGGCTGG - Intergenic
971207270 4:24583490-24583512 TCCCATGGGGAGGGATTAGAAGG - Intronic
973229462 4:47825009-47825031 TCCCAGGTGGAGTGACTCCCTGG - Intronic
973799205 4:54459771-54459793 TCCCAAATGGAGGGACTGACTGG + Intergenic
975006670 4:69297022-69297044 TCCCGAATGGAGGGACTGGGTGG - Intronic
975722832 4:77264901-77264923 TCCCAAATGGAGGGACAAGCTGG - Intronic
979395900 4:120188791-120188813 TCCAAAGTCAAGGGACTGGATGG + Intergenic
981424618 4:144588747-144588769 CCCCAAATGGAGGGACTGGCTGG - Intergenic
981750590 4:148089875-148089897 ACCCACATGGAGGGACTCCAGGG - Intronic
983190882 4:164752261-164752283 CCCCAAATGGAGGGACTGGCTGG + Intergenic
985549403 5:525381-525403 TCCCAATAGGAGGGACTGAAGGG - Intergenic
991099708 5:62779057-62779079 TCCCAAGTGGAGAGATCCCAAGG + Intergenic
993533292 5:89049772-89049794 CCCCAAATGGAGGGACTGGCTGG + Intergenic
995187470 5:109287284-109287306 TCCCAAATGGAGGGACCAGCTGG - Intergenic
1000880683 5:166693574-166693596 CCCCAAATGGAGGGACTGGCTGG - Intergenic
1001870089 5:175146421-175146443 CCCCAAATGGAGGGACTGGCTGG + Intergenic
1004086498 6:12454542-12454564 CCCCAAATGGAGGGACTGGCTGG - Intergenic
1004522248 6:16373056-16373078 GCCCAAGTGGAGGGACACATAGG + Intronic
1004622407 6:17342647-17342669 TCCCAAGTGCTGGCACTCAATGG + Intergenic
1005087894 6:22025610-22025632 TCCCAAGTGCAGGGGGTGGAGGG - Intergenic
1005360521 6:25027341-25027363 TCCCAGGGGGAGGCGCTCGAGGG + Intronic
1009871057 6:69452370-69452392 TCCCAAGTGTATGGACAAGATGG + Intergenic
1010796589 6:80123415-80123437 TCCCAAATGGAGGGACTGGCTGG - Intronic
1014239427 6:118998667-118998689 TTCCATGTGGAGGGACTGGTAGG + Intronic
1020836348 7:13156721-13156743 ACCCAACTGGAGAGACTGGAGGG - Intergenic
1022040268 7:26574729-26574751 TCCCATTTGGAGGGAGTGGATGG - Intergenic
1023609149 7:41956710-41956732 TTCCAATTGGAGTGACTAGAGGG + Intergenic
1024563496 7:50663441-50663463 TCCCAAGTGGAGGGACTCGATGG - Intronic
1026313541 7:69208878-69208900 ACCCAAGTAGATGGACTGGACGG + Intergenic
1026970267 7:74463491-74463513 TCCCAAGTGCTGGGATTAGAGGG + Intronic
1037142844 8:15539474-15539496 TCCCAAGTAGAGGAACTGCAAGG + Intronic
1037943920 8:22974688-22974710 TTCCCAGTGGAGGGGCTTGATGG - Intronic
1039545768 8:38410068-38410090 TCCTCAGTGGAGGGAATGGAAGG + Intergenic
1041985949 8:63922686-63922708 GGCCAAGTGGAGGTACTCAACGG + Intergenic
1045270564 8:100657651-100657673 TCTGAAGTGGAGGGACAAGATGG + Intronic
1045400573 8:101812660-101812682 TCCCAAGTGGACAGACTTCATGG - Intronic
1048493816 8:134919145-134919167 GCCCAAGTGGAGGGAATGCATGG + Intergenic
1051213499 9:14771104-14771126 TGCCAAGTGCAGGGAATCCATGG - Intronic
1055846002 9:80564173-80564195 TGCCAAGTGGAGGGAGAAGATGG + Intergenic
1057798901 9:98177313-98177335 TCCCAAGGGGAGAGACCCCATGG - Intronic
1058143717 9:101385959-101385981 CCCCAAATGGAGGGACTGGCTGG - Intergenic
1058583899 9:106486390-106486412 TCGCAGCTGGAGGGACTCGGAGG + Intergenic
1061660297 9:132125610-132125632 TCCCTTGTGGAGGGGCTGGAGGG - Intergenic
1191191679 X:57674879-57674901 CCCCAAATGGAGGGACTGGCTGG - Intergenic
1193300789 X:79886335-79886357 CCCCAAATGGAGGGACCAGATGG - Intergenic
1199637506 X:149827151-149827173 TCCCTAGGGGAGGGACTGGCAGG - Intergenic
1201616802 Y:15909472-15909494 CCCCAAATGGAGGGACTAGCTGG - Intergenic