ID: 1024563497

View in Genome Browser
Species Human (GRCh38)
Location 7:50663450-50663472
Sequence TGGCACTCATCCCAAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 97}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024563497_1024563503 1 Left 1024563497 7:50663450-50663472 CCCTCCACTTGGGATGAGTGCCA 0: 1
1: 0
2: 0
3: 11
4: 97
Right 1024563503 7:50663474-50663496 GTGACTAGGGTCCTTCTCACAGG No data
1024563497_1024563504 2 Left 1024563497 7:50663450-50663472 CCCTCCACTTGGGATGAGTGCCA 0: 1
1: 0
2: 0
3: 11
4: 97
Right 1024563504 7:50663475-50663497 TGACTAGGGTCCTTCTCACAGGG 0: 1
1: 0
2: 2
3: 22
4: 218
1024563497_1024563505 9 Left 1024563497 7:50663450-50663472 CCCTCCACTTGGGATGAGTGCCA 0: 1
1: 0
2: 0
3: 11
4: 97
Right 1024563505 7:50663482-50663504 GGTCCTTCTCACAGGGATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024563497 Original CRISPR TGGCACTCATCCCAAGTGGA GGG (reversed) Intronic
900253317 1:1683247-1683269 TGGCACTCTCCCCAGGGGGACGG - Intronic
901349477 1:8580819-8580841 TGGCACACAACTCAAGTGGGAGG - Intronic
901701355 1:11046364-11046386 TGGCACTCAGCCCATGTGAATGG + Intronic
904801238 1:33094299-33094321 TGGCTCTCATCCCAGAAGGAGGG + Intronic
907275000 1:53312031-53312053 CCTCACTCCTCCCAAGTGGAGGG - Intronic
909471010 1:76028003-76028025 TGCCACTCATCTCAAATGGTGGG - Intergenic
911230039 1:95351440-95351462 TGGGACTTATCTCAAGTTGAAGG + Intergenic
912866633 1:113263430-113263452 TGCCATTCCTCCCAAGTGTAGGG - Intergenic
915287401 1:154861705-154861727 TGGCATCCATCCCAGGCGGACGG - Intronic
916717306 1:167456165-167456187 TGGCACACATACCCAGTGCATGG + Intronic
916810029 1:168297262-168297284 TGGCACTCATCCAGAGGGGCAGG + Intronic
920217214 1:204369456-204369478 TGGCAGTCTCCCCAAGTAGAGGG + Intronic
923230788 1:231984474-231984496 TGTTCCTCATCCCTAGTGGATGG + Intronic
1063122485 10:3114692-3114714 GGACACTCATCCCAGGTGGAGGG + Intronic
1065598943 10:27348789-27348811 TAGCACTTGTCACAAGTGGAAGG - Intergenic
1067792313 10:49297761-49297783 TGGCTCCCATCTCAAGTTGATGG + Intergenic
1069546927 10:69335346-69335368 TGGCTCTGATCCCAGCTGGAGGG + Intronic
1069587578 10:69618744-69618766 TGGCACTCAGACCACCTGGAAGG + Intergenic
1070578909 10:77704020-77704042 GGGCACTAATCCCATTTGGAAGG - Intergenic
1073508539 10:104024896-104024918 AGGCACTCATCCCATTTGGAGGG + Intronic
1073956570 10:108878410-108878432 TGGAACTAATCCCTTGTGGAAGG - Intergenic
1084632521 11:70363266-70363288 AGGCACTCATCCCTAGGGAAGGG - Intronic
1087277380 11:96174105-96174127 TGCCCCTCATGCCATGTGGAAGG - Intronic
1090650816 11:128804403-128804425 TGGGACTCATACCAAGAGAAAGG + Intronic
1097053353 12:56236676-56236698 TGGCACTGATATCACGTGGATGG + Exonic
1098579338 12:72080268-72080290 TGGCACACCTCCCAAGTAGCTGG - Intronic
1098945379 12:76583842-76583864 TGCCACTTTCCCCAAGTGGAAGG + Intergenic
1099184058 12:79498663-79498685 ACCTACTCATCCCAAGTGGAAGG - Intergenic
1099290078 12:80765689-80765711 AGGCCCTCATCCCAAGTAGCTGG - Intergenic
1101083575 12:101213164-101213186 TGGCAATCATCTCAAATGGAAGG + Intergenic
1107338537 13:39381576-39381598 TGGAACTCTTCCTAAGTGGGAGG - Intronic
1113994292 14:16053657-16053679 TGGGAAGCATCCCAAGTGGGGGG + Intergenic
1115514005 14:34167125-34167147 TGGCACTGATCCCCAGAGGGTGG + Intronic
1118074306 14:62281680-62281702 GGGCACTCATCCCATTAGGAGGG + Intergenic
1122853634 14:104549389-104549411 TGGGACTCCTCCCCACTGGACGG - Intronic
1122999033 14:105282177-105282199 TGGCAACCATCCCAGGGGGAAGG + Intronic
1127853318 15:62934356-62934378 TGGCACTCATCCCAATTCTGTGG + Intergenic
1128290605 15:66475708-66475730 TGGCACCCATCCCACCTGGTTGG + Intronic
1136082603 16:27861976-27861998 TGTGACCCAACCCAAGTGGACGG + Intronic
1136337308 16:29618555-29618577 TGGCACCCAACGCAAGTGCAGGG - Intergenic
1136912842 16:34159025-34159047 TGGGAAGCATCCCAAGTGGGGGG + Intergenic
1139131224 16:64148468-64148490 TGTGCCCCATCCCAAGTGGATGG + Intergenic
1141666403 16:85467763-85467785 TGACACTCTTCCCATCTGGAGGG - Intergenic
1142040107 16:87887899-87887921 TGGCACCCAACGCAAGTGCAGGG - Exonic
1147966481 17:44197019-44197041 TGGCAATCCTGCCAAGGGGAGGG + Exonic
1149471061 17:56915434-56915456 CGGCACTCCTCCCAAGTAGCTGG + Intergenic
1150220319 17:63492351-63492373 TGCCACTTCTCCCAAGTGGGAGG - Intronic
1150613164 17:66749530-66749552 TGGCACTCATCCCCCTTGGAGGG + Intronic
1157092710 18:44654875-44654897 TTGTACTTATCCCAAGTAGAGGG + Intergenic
1160008464 18:75086042-75086064 TGGCAGTCCTACTAAGTGGAAGG + Intergenic
1161044359 19:2127121-2127143 TGGCACTCTCCCCATCTGGAAGG - Intronic
1162376008 19:10305691-10305713 GGTGACTCAGCCCAAGTGGAGGG + Intronic
1164465188 19:28481799-28481821 TTGCATTCCTCCCAAGTGGTAGG - Intergenic
1165694654 19:37891768-37891790 TGGCCCGCATCCCCAGTAGATGG + Exonic
1166540239 19:43600270-43600292 TGGGACTCATCTCCAGTTGAGGG - Exonic
924996435 2:365936-365958 TGGCCGTCATCACAAGTGGGGGG + Intergenic
925163200 2:1701280-1701302 TGACATTCACCCCAAGTGCATGG - Intronic
925334318 2:3082373-3082395 TGCCACTGAGCCCAAGGGGAGGG - Intergenic
926349684 2:11983617-11983639 GGGCAATGATCCAAAGTGGAGGG + Intergenic
926624930 2:15083121-15083143 TGGAGCTCATCTTAAGTGGAGGG + Intergenic
931767367 2:65468703-65468725 TTTCATTCATCCCTAGTGGATGG - Intergenic
933830807 2:86206740-86206762 AGGCTGTCATCCAAAGTGGAGGG + Intronic
938763876 2:134447687-134447709 GAGCAGTCATCCCAAGTGGGAGG + Intronic
944759419 2:202798351-202798373 TGGGACTCATCCCAAGTAGCTGG + Intronic
945959146 2:216114207-216114229 TGGCAGTCATACCAAGTAGAAGG - Intronic
946475286 2:220000930-220000952 TGGTAGTCATTCCTAGTGGATGG + Intergenic
1171768123 20:29301163-29301185 TGGGAAGCATCCCAAGTGGGGGG - Intergenic
1178289805 21:31357505-31357527 TGGACCTCATCACAAGTGGAGGG - Intronic
1180312977 22:11253858-11253880 TGGGAAGCATCCCAAGTGGGGGG - Intergenic
1183193174 22:36334987-36335009 TGGCACTATTCCCAAGTCTAAGG + Intronic
1184119630 22:42441386-42441408 GCGCCCTCATCCCAAGAGGAAGG - Intergenic
953877756 3:46676151-46676173 TGGCATTCCTCCCAAATGCAAGG + Intronic
954744287 3:52778241-52778263 TGGCACTTAGCCCCAGTGCATGG - Intronic
955863402 3:63356177-63356199 TGGCCTTCATGCCAAGTTGATGG - Intronic
957381121 3:79431151-79431173 TGGCCCTCATGCCAAGTTGCTGG - Intronic
959450436 3:106492596-106492618 TTACACTCATCCCAACGGGAAGG + Intergenic
959587722 3:108040700-108040722 GGGCTCTCATCCCATGTGGTGGG + Intergenic
968943015 4:3648932-3648954 TGGCCCTCAGCCCAAGCGGCCGG + Intergenic
969149282 4:5154927-5154949 TGGCACATATCCCGAGTGGGAGG - Intronic
969592280 4:8128774-8128796 GGGCACTCATCCCATGATGAGGG - Intronic
977514645 4:98006297-98006319 TTGCACTGTTCCCCAGTGGAAGG - Intronic
982640904 4:157959361-157959383 TGGCATTTATCTCAAGGGGATGG - Intergenic
988313706 5:29595467-29595489 TGGCACTCAAATCAAGTAGATGG + Intergenic
991917980 5:71624156-71624178 GGGCACTAATCCCATGGGGAGGG + Intronic
992104032 5:73436058-73436080 TCGCCCTCATCCCAAGCTGAAGG - Intergenic
996843082 5:127869540-127869562 TGGAATTCATCCCAAGTGTAAGG + Intergenic
999475669 5:151896247-151896269 TGGCACTGAGCCGAAGTGGAGGG + Intronic
1001178940 5:169500334-169500356 AGGCACTCATGTCAAGTGGGAGG + Intergenic
1003115926 6:3283964-3283986 TGTCACTCATCCCTGGGGGAAGG + Exonic
1004094552 6:12539660-12539682 GGGCACTCATCAAAAGTTGATGG + Intergenic
1006611557 6:35297273-35297295 TGGGACTCCATCCAAGTGGAAGG - Intergenic
1017177700 6:151520224-151520246 TGGCACTTATCACAAGGGGAAGG - Intronic
1019853675 7:3583836-3583858 TGGCAGGCATTTCAAGTGGAGGG + Intronic
1021617257 7:22515351-22515373 TCCCTATCATCCCAAGTGGATGG - Intronic
1024563497 7:50663450-50663472 TGGCACTCATCCCAAGTGGAGGG - Intronic
1026592213 7:71706753-71706775 TGGCTCTTATCCCAAAAGGAGGG - Intronic
1027268162 7:76505225-76505247 TGGCACTCACCCCATCTGCAGGG - Intronic
1028375420 7:90140763-90140785 TCCCTATCATCCCAAGTGGATGG + Intergenic
1029050479 7:97681478-97681500 TGGAATTCATCCCAAGAGGGTGG + Intergenic
1044066197 8:87703244-87703266 TTGCCCTCTTCTCAAGTGGAAGG - Intergenic
1049494307 8:142922558-142922580 AGGCACTCACTCCAAGTTGAGGG + Intergenic
1050206063 9:3197517-3197539 GGGAAATGATCCCAAGTGGAAGG + Intergenic
1058720571 9:107760216-107760238 TCTCAATCATCCCAAGTAGAGGG + Intergenic
1061887476 9:133599069-133599091 TGGCGCTCAGGCCAGGTGGAAGG - Intergenic
1062097785 9:134711872-134711894 TGGCCCTCCCCGCAAGTGGATGG + Intronic
1187421166 X:19135033-19135055 TGTCTCTCATCCCCACTGGAAGG - Intergenic
1189239930 X:39517140-39517162 TGGCAAGCAGCCCAGGTGGAAGG + Intergenic
1190110587 X:47586559-47586581 TGGCACTCATTGCTTGTGGACGG + Exonic
1198306724 X:135391067-135391089 TCACATTCATCCCAAGTGTAGGG - Intergenic