ID: 1024563498

View in Genome Browser
Species Human (GRCh38)
Location 7:50663451-50663473
Sequence ATGGCACTCATCCCAAGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024563498_1024563503 0 Left 1024563498 7:50663451-50663473 CCTCCACTTGGGATGAGTGCCAT 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1024563503 7:50663474-50663496 GTGACTAGGGTCCTTCTCACAGG No data
1024563498_1024563504 1 Left 1024563498 7:50663451-50663473 CCTCCACTTGGGATGAGTGCCAT 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1024563504 7:50663475-50663497 TGACTAGGGTCCTTCTCACAGGG 0: 1
1: 0
2: 2
3: 22
4: 218
1024563498_1024563505 8 Left 1024563498 7:50663451-50663473 CCTCCACTTGGGATGAGTGCCAT 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1024563505 7:50663482-50663504 GGTCCTTCTCACAGGGATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024563498 Original CRISPR ATGGCACTCATCCCAAGTGG AGG (reversed) Intronic
901292182 1:8132735-8132757 AGAGCACTCATCCCCAGAGGCGG - Intergenic
905789282 1:40781910-40781932 ATGGCTCTCTTCCCAGCTGGGGG - Intergenic
906920167 1:50055620-50055642 AAGGAACTTATCCCAACTGGTGG + Intronic
908169361 1:61489212-61489234 ATGGCAGTTAGCCCAAGGGGTGG - Intergenic
909471011 1:76028004-76028026 GTGCCACTCATCTCAAATGGTGG - Intergenic
912866634 1:113263431-113263453 ATGCCATTCCTCCCAAGTGTAGG - Intergenic
914490508 1:148147986-148148008 ACGGGACACATCCCCAGTGGAGG - Intronic
915895618 1:159808969-159808991 ATGGCACTCAGCACAGGAGGTGG - Exonic
917000150 1:170348900-170348922 ATGGCACTGATCACAAGAGAAGG - Intergenic
917614161 1:176721009-176721031 ATGGCACTCATCCACACTGAGGG + Intronic
920453810 1:206082174-206082196 AAGGGACTCAGCCCAAGGGGTGG + Intronic
920717350 1:208352867-208352889 AGGGCACTCATCCCATCTGTGGG + Intergenic
1063122484 10:3114691-3114713 GGGACACTCATCCCAGGTGGAGG + Intronic
1071871270 10:89797232-89797254 ATAGCACTCAGCACATGTGGAGG + Intergenic
1073040376 10:100600081-100600103 AAGGCACTCAACACAAGTGAGGG - Intergenic
1073508538 10:104024895-104024917 AAGGCACTCATCCCATTTGGAGG + Intronic
1078157728 11:8813258-8813280 ATGGCACAAATCCTAAATGGGGG + Intronic
1078624858 11:12945784-12945806 ATGGCATTCCTCTCAAATGGTGG - Intergenic
1084902689 11:72321603-72321625 ATGGCAGGCATCCCAACTGTTGG + Intronic
1084988174 11:72896438-72896460 ATGGCACTCATCACTAGTTCTGG + Intronic
1085475905 11:76788789-76788811 CTGGCTCTGATCCCAGGTGGGGG + Intronic
1091155610 11:133368782-133368804 ATGGCTCCTATCCTAAGTGGAGG - Intronic
1094481600 12:30886516-30886538 GTGGCCCTGATTCCAAGTGGAGG - Intergenic
1097945849 12:65366668-65366690 ATGGCACTCATCAAAAATGATGG - Intronic
1098154687 12:67585454-67585476 ATGTCTCTCATCACATGTGGTGG - Intergenic
1099352811 12:81593865-81593887 AAGGCAGTGATCCCAACTGGTGG + Intronic
1104847249 12:131852731-131852753 ATGGCACCCATCCCAGGATGAGG + Intergenic
1105487963 13:20856378-20856400 GAAGCACCCATCCCAAGTGGAGG + Intronic
1106818245 13:33433847-33433869 AAGGAACTCATCACAAATGGGGG - Intergenic
1113994291 14:16053656-16053678 CTGGGAAGCATCCCAAGTGGGGG + Intergenic
1118074305 14:62281679-62281701 AGGGCACTCATCCCATTAGGAGG + Intergenic
1118887223 14:69877759-69877781 AAAGCACTCATTCCCAGTGGAGG + Intronic
1119639517 14:76304283-76304305 ATGGCCCCCCACCCAAGTGGGGG - Intergenic
1120967493 14:90180765-90180787 ATGTCACTCATCCCAAAGTGAGG + Intronic
1124528470 15:30480368-30480390 ATGGCACTAATCCCATGATGGGG + Intergenic
1124770187 15:32527330-32527352 ATGGCACTAATCCCATGATGGGG - Intergenic
1127241299 15:57117732-57117754 ATGGCCTTCATCCAAAGTTGGGG - Intronic
1130835319 15:87644557-87644579 ATGGCAATCCTCTGAAGTGGTGG - Intergenic
1136337309 16:29618556-29618578 ATGGCACCCAACGCAAGTGCAGG - Intergenic
1136912841 16:34159024-34159046 ATGGGAAGCATCCCAAGTGGGGG + Intergenic
1138408993 16:56822863-56822885 ATGTGACTCTTCCTAAGTGGTGG - Intronic
1138453989 16:57110743-57110765 ATGGCCCACATACCCAGTGGGGG + Exonic
1139560358 16:67737889-67737911 ATGGCACACATCCCTGGTTGGGG + Intronic
1139958040 16:70702533-70702555 ATGGGAGTCATCCTCAGTGGAGG - Intronic
1142040108 16:87887900-87887922 ATGGCACCCAACGCAAGTGCAGG - Exonic
1142512041 17:402180-402202 ATGCCAGTGATCCCAAGTGAGGG - Intergenic
1143082756 17:4393920-4393942 ATGTTACTCATCCCAGGTGAGGG - Intergenic
1144418015 17:15069992-15070014 ATGGCGCCTCTCCCAAGTGGAGG + Intergenic
1148242574 17:46010220-46010242 ATGTCACTCATCGAAAGTGGAGG + Intronic
1150613163 17:66749529-66749551 ATGGCACTCATCCCCCTTGGAGG + Intronic
1153460058 18:5323127-5323149 ATGGCTCTGATCCCAAATGCTGG + Intergenic
1153987380 18:10365271-10365293 ATGGCACTCCTCATATGTGGAGG - Intergenic
1157092709 18:44654874-44654896 ATTGTACTTATCCCAAGTAGAGG + Intergenic
1157707247 18:49817808-49817830 ATGCCACCCCTCCCAAGTGCCGG - Intronic
1164443714 19:28299740-28299762 ATGGCACACATCCCCAGAAGGGG - Intergenic
924996434 2:365935-365957 TTGGCCGTCATCACAAGTGGGGG + Intergenic
926349683 2:11983616-11983638 AGGGCAATGATCCAAAGTGGAGG + Intergenic
926624929 2:15083120-15083142 ATGGAGCTCATCTTAAGTGGAGG + Intergenic
930512172 2:52359052-52359074 AATACACTCATTCCAAGTGGTGG - Intergenic
933194582 2:79373898-79373920 TTGGCACTCATCCTGAGTGCTGG - Intronic
934575418 2:95397514-95397536 AGGGCATTCACCCCAAGTGAGGG + Intergenic
941646472 2:168046533-168046555 ACCCCACTCCTCCCAAGTGGAGG + Intronic
943903985 2:193474666-193474688 GTGGCCCCCATCCCCAGTGGAGG - Intergenic
944591657 2:201223339-201223361 AGGGAACTCACCACAAGTGGGGG + Intronic
1171768124 20:29301164-29301186 CTGGGAAGCATCCCAAGTGGGGG - Intergenic
1172128330 20:32638772-32638794 ATGGCAGCCAGCCCATGTGGAGG - Intergenic
1178289806 21:31357506-31357528 TTGGACCTCATCACAAGTGGAGG - Intronic
1180312978 22:11253859-11253881 CTGGGAAGCATCCCAAGTGGGGG - Intergenic
1180342266 22:11628499-11628521 ATGGGAAGCTTCCCAAGTGGGGG + Intergenic
1180966025 22:19788351-19788373 AGGGCACTGATGCTAAGTGGGGG + Exonic
1181121169 22:20669373-20669395 ACGGGACACATCCCCAGTGGAGG + Intergenic
1181334129 22:22116399-22116421 ACGGGACACATCCCCAGTGGAGG + Intergenic
950645466 3:14374206-14374228 AGGTCACACAGCCCAAGTGGCGG + Intergenic
955090943 3:55749820-55749842 ATGGCACTGATCCAAAGAGTGGG - Intronic
958012342 3:87896071-87896093 ATGTCACTCTTTCAAAGTGGGGG - Intergenic
959147757 3:102569877-102569899 CTGTCAATCATCCCAAGTAGTGG - Intergenic
959587721 3:108040699-108040721 AGGGCTCTCATCCCATGTGGTGG + Intergenic
960909378 3:122633863-122633885 ATGGGACTAATCCAAAGTTGGGG - Intronic
963669788 3:148236806-148236828 ATGGGAGTCATCCAAAGCGGAGG + Intergenic
964327989 3:155567969-155567991 ATGGCATCCATCACACGTGGTGG + Intronic
967527172 3:190508446-190508468 AGGGCACTACTCCCACGTGGAGG - Intergenic
967698007 3:192555870-192555892 ATGGCACTGATACCATGGGGAGG + Intronic
969340012 4:6534779-6534801 ATGGCACTCGCCCCCAGTCGGGG + Intronic
969592281 4:8128775-8128797 AGGGCACTCATCCCATGATGAGG - Intronic
972900339 4:43673975-43673997 ATTGCACTCAGCCCAGGTGACGG - Intergenic
985947500 5:3197786-3197808 AGGGGACTCATCGCAAGTGACGG - Intergenic
991917979 5:71624155-71624177 AGGGCACTAATCCCATGGGGAGG + Intronic
992344672 5:75864847-75864869 ATGTCACTCATCACATGTGCTGG - Intergenic
993761646 5:91802951-91802973 AGGGCACTCACCCCATGTGATGG + Intergenic
995242002 5:109895909-109895931 ATGAAACTGATCCCAAGTGTGGG - Intergenic
998569678 5:143246025-143246047 AATGCACGCATTCCAAGTGGCGG - Intergenic
998902555 5:146871408-146871430 ATGTCACTCATCCCCAGTGTAGG - Intronic
999475668 5:151896246-151896268 TTGGCACTGAGCCGAAGTGGAGG + Intronic
1011984036 6:93419629-93419651 CTGCCACTCAGCCCGAGTGGCGG - Intergenic
1013165107 6:107583046-107583068 CTGGCACCCCACCCAAGTGGGGG + Intronic
1017699525 6:157054902-157054924 AGCTCACTCATCCCCAGTGGTGG + Intronic
1024563498 7:50663451-50663473 ATGGCACTCATCCCAAGTGGAGG - Intronic
1029897340 7:103997607-103997629 ATGGCCCTCATGGGAAGTGGAGG - Intergenic
1032932653 7:136691583-136691605 ATGGCCCACATTCCAAGTGATGG + Intergenic
1038622025 8:29153446-29153468 ATGGCATTCAACAGAAGTGGTGG + Intronic
1047354094 8:124103914-124103936 AATGCACTCATCCCAAGGGGAGG - Intronic
1049494306 8:142922557-142922579 AAGGCACTCACTCCAAGTTGAGG + Intergenic
1050296529 9:4210843-4210865 ATGGCAGACATTCCAAGTTGGGG - Intronic
1186635591 X:11400945-11400967 ATGGATCTGATTCCAAGTGGAGG - Intronic
1187206465 X:17186419-17186441 ATGGCACTCACCTCAAGAGAGGG - Intergenic
1188462593 X:30445791-30445813 GTACCACTCATCCCAACTGGAGG + Intergenic
1189229424 X:39440648-39440670 ATGGCAGTCAGCCCTAGTGATGG - Intergenic
1199763008 X:150919635-150919657 ATGGCACTGAGCCCATGTGAAGG - Intergenic
1201076975 Y:10196208-10196230 CTGGGAAGCATCCCAAGTGGGGG + Intergenic