ID: 1024563499

View in Genome Browser
Species Human (GRCh38)
Location 7:50663454-50663476
Sequence CACATGGCACTCATCCCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 98}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024563499_1024563505 5 Left 1024563499 7:50663454-50663476 CCACTTGGGATGAGTGCCATGTG 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1024563505 7:50663482-50663504 GGTCCTTCTCACAGGGATAATGG No data
1024563499_1024563504 -2 Left 1024563499 7:50663454-50663476 CCACTTGGGATGAGTGCCATGTG 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1024563504 7:50663475-50663497 TGACTAGGGTCCTTCTCACAGGG 0: 1
1: 0
2: 2
3: 22
4: 218
1024563499_1024563503 -3 Left 1024563499 7:50663454-50663476 CCACTTGGGATGAGTGCCATGTG 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1024563503 7:50663474-50663496 GTGACTAGGGTCCTTCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024563499 Original CRISPR CACATGGCACTCATCCCAAG TGG (reversed) Intronic
902208472 1:14887340-14887362 AACATGGCACTCATGCCGAAAGG - Intronic
902835930 1:19046829-19046851 CACATGTCACTCTTCAAAAGGGG + Intergenic
903917376 1:26774354-26774376 CATATGGCCCTCCTGCCAAGCGG + Exonic
905886238 1:41493610-41493632 CCCAGGGCACACATCCTAAGGGG - Intergenic
908187964 1:61670781-61670803 CACATTCCAGTCATCTCAAGGGG + Intergenic
911836712 1:102628740-102628762 CACTGGGCACTCCTCTCAAGAGG + Intergenic
912410443 1:109477531-109477553 CAAAACCCACTCATCCCAAGTGG - Intronic
913406275 1:118495381-118495403 GACCTGGCATTCATCCCAATAGG - Intergenic
915287402 1:154861709-154861731 CAGATGGCATCCATCCCAGGCGG - Intronic
916132609 1:161624436-161624458 CACATGACCCCCATCCCATGGGG - Exonic
916810028 1:168297258-168297280 TAGATGGCACTCATCCAGAGGGG + Intronic
919047886 1:192476178-192476200 CACATAGCACCCCTCCCAACAGG - Intergenic
920084260 1:203403612-203403634 TATATGGTACTTATCCCAAGAGG + Intergenic
920200754 1:204258471-204258493 TTCTTGGGACTCATCCCAAGTGG + Intronic
920399932 1:205670228-205670250 CACATGGCACCCCTCACAAAGGG - Intronic
920452718 1:206072248-206072270 AACATGGCCCTTATTCCAAGAGG + Intronic
924676373 1:246182386-246182408 CACATAGAACTGATCCAAAGGGG + Intronic
1070830122 10:79413096-79413118 CACAAGCCACTCATCCAAAATGG + Intronic
1077921587 11:6646066-6646088 CTCATGGCCCTCACACCAAGAGG + Intronic
1090919564 11:131196001-131196023 TCCCTGGCACTCATCCCAAAAGG - Intergenic
1091013901 11:132032076-132032098 CACTCTGCACACATCCCAAGTGG + Intronic
1095796784 12:46228015-46228037 AACCTGGCACTCAGCTCAAGCGG + Intronic
1095972264 12:47910384-47910406 CACAAGACACTCTTCCCCAGAGG - Intronic
1101839346 12:108316665-108316687 CAAATGGCCCTCACCCCAGGAGG - Intronic
1102409137 12:112702011-112702033 CACCTAGTACTTATCCCAAGTGG - Intronic
1104370935 12:128223402-128223424 CACATGGCAATAATCCGCAGAGG + Intergenic
1107922827 13:45228118-45228140 CAAATGCCACTGATCTCAAGAGG - Intronic
1115846228 14:37538853-37538875 CACATGCCACCCAGCCCCAGTGG + Intronic
1118244195 14:64092831-64092853 CACACATCACTGATCCCAAGGGG + Intronic
1119914979 14:78390473-78390495 CACACCCCACTCATTCCAAGTGG + Intronic
1120434644 14:84465882-84465904 CACATGGCATTAAACACAAGGGG - Intergenic
1125165411 15:36698559-36698581 CACAGGTCACTCATTCCAACTGG - Intronic
1127678998 15:61274679-61274701 CAACTGGGACTCAGCCCAAGTGG + Intergenic
1127933225 15:63611504-63611526 CACAAGGCACACAACACAAGTGG + Intronic
1132464040 16:69468-69490 CACATGAGCCTCATCCCAGGGGG + Intronic
1139561989 16:67748951-67748973 CACATCCCTCTCCTCCCAAGTGG + Intronic
1142243784 16:88959169-88959191 CACATGGCACACAGCACATGTGG - Intronic
1142260619 16:89040991-89041013 CACTGGGCACTGACCCCAAGTGG + Intergenic
1146255535 17:31390027-31390049 CACAGGTCTCTCTTCCCAAGAGG + Intergenic
1148242573 17:46010217-46010239 CGCATGTCACTCATCGAAAGTGG + Intronic
1152033682 17:77858778-77858800 CTGATGGCACTCACCCCCAGTGG + Intergenic
1152154002 17:78621210-78621232 CACATTTCCCTCACCCCAAGAGG - Intergenic
1157471299 18:47991129-47991151 CACAAGGGACTCAGCCCCAGGGG + Intergenic
1160008463 18:75086038-75086060 CACATGGCAGTCCTACTAAGTGG + Intergenic
1162100726 19:8336993-8337015 CCTATGGCACTAATCGCAAGTGG - Intronic
1165429566 19:35764862-35764884 CACATGGAACTCATCCCTGCTGG + Exonic
1166445761 19:42856338-42856360 CACAGGCCTCTCCTCCCAAGAGG - Intronic
1166448748 19:42880298-42880320 CACAGGCCTCTCCTCCCAAGAGG - Intronic
1166453156 19:42918486-42918508 CACAGGCCTCTCCTCCCAAGAGG - Intronic
1166455638 19:42937797-42937819 CACAGGCCTCTCCTCCCAAGAGG - Intronic
1166482703 19:43187092-43187114 CACAGGCCTCTCCTCCCAAGAGG - Intronic
1166485176 19:43206226-43206248 CACAGGCCTCTCCTCCCAAGAGG - Intronic
1167318061 19:48777888-48777910 CACATGGCATAGATACCAAGAGG - Intergenic
925436607 2:3843525-3843547 CAAATGGCATTCATCCCCATAGG + Intronic
925621048 2:5793252-5793274 CCCAGGGCTCTCATCCCAGGCGG - Intergenic
930872179 2:56181508-56181530 CACGAGGCAATCATCCCAAAGGG + Intergenic
934774470 2:96928402-96928424 CACGTGGCACTCCTCCCCACAGG + Intronic
936795649 2:116200774-116200796 CACATGGGACTTATACAAAGAGG - Intergenic
942394707 2:175535120-175535142 CAGGTGGTACTCATCCCCAGTGG + Intergenic
943565736 2:189514064-189514086 CACAGGGCACTCATCCGAATTGG + Intergenic
948722619 2:239911131-239911153 CACATAGAACCCATTCCAAGGGG - Intronic
1172594238 20:36139078-36139100 CACAAGGCAATCACCACAAGAGG - Intronic
1175269528 20:57724016-57724038 CACATGCCACACATCGCCAGAGG - Intergenic
1175569678 20:60009459-60009481 CACATACCGCTCATGCCAAGTGG + Intronic
1181181748 22:21073400-21073422 CAACTGGCTCTCATCCCAACTGG + Intergenic
1182326461 22:29517034-29517056 TACATGGCGCTCATCGAAAGGGG - Exonic
955604012 3:60680072-60680094 CCCATGGCCCACATGCCAAGGGG - Intronic
959587720 3:108040696-108040718 CACAGGGCTCTCATCCCATGTGG + Intergenic
963669787 3:148236803-148236825 CTCATGGGAGTCATCCAAAGCGG + Intergenic
963926967 3:150960980-150961002 CACTTGGCTCTCAGCCCCAGTGG - Intronic
967527173 3:190508449-190508471 CACAGGGCACTACTCCCACGTGG - Intergenic
968979762 4:3840805-3840827 CTCCAAGCACTCATCCCAAGAGG + Intergenic
970417917 4:15877534-15877556 CACAAGGCTCTCCTCCCAATGGG + Intergenic
971054390 4:22896365-22896387 CACATGGCACTCCTCCCCTCCGG + Intergenic
976672558 4:87669969-87669991 GGCATAACACTCATCCCAAGGGG + Intergenic
981308405 4:143270308-143270330 TACATGGCATTTATCCCAAAGGG + Intergenic
981918072 4:150056716-150056738 CACAAGCCACTCATCCCACATGG + Intergenic
983155133 4:164337605-164337627 CACATGCCAGATATCCCAAGTGG - Intronic
995038392 5:107561311-107561333 CACATGGCTCTTAACACAAGTGG - Intronic
1000591091 5:163158312-163158334 CACATGGCACTCAGCTGAAGGGG + Intergenic
1002971821 6:2030587-2030609 CACATGTCATTCATCCCCAGAGG - Intronic
1007715661 6:43854626-43854648 CACATGGCGGTCAGCCCCAGAGG - Intergenic
1008887202 6:56444336-56444358 CAAATGCCACTCTTTCCAAGAGG + Intergenic
1010305452 6:74316292-74316314 GACATGCAACTCATCCCAAAGGG - Intergenic
1017177702 6:151520228-151520250 CTCCTGGCACTTATCACAAGGGG - Intronic
1017734208 6:157346184-157346206 CACAAGGCACCTGTCCCAAGAGG - Intergenic
1020323513 7:6957385-6957407 CTCGTGGCAATCAGCCCAAGTGG + Intergenic
1022560039 7:31338352-31338374 AACATGGCACCCTGCCCAAGGGG + Exonic
1024563499 7:50663454-50663476 CACATGGCACTCATCCCAAGTGG - Intronic
1027332112 7:77107877-77107899 TACATGGCATTGGTCCCAAGAGG + Intergenic
1029050477 7:97681474-97681496 GTCATGGAATTCATCCCAAGAGG + Intergenic
1029783663 7:102763448-102763470 TACATGGCATTGGTCCCAAGAGG - Intronic
1031018726 7:116603860-116603882 TACATGGAACTGATCGCAAGTGG + Intergenic
1043106496 8:76119374-76119396 CACATGGAACTGTTCCCCAGAGG + Intergenic
1047354095 8:124103917-124103939 CAGAATGCACTCATCCCAAGGGG - Intronic
1047604003 8:126456180-126456202 GACATGGCACTCATCCCCATTGG - Intergenic
1047948777 8:129910263-129910285 CACATGGCCCTCTGCACAAGGGG - Intronic
1049422817 8:142524423-142524445 CTCATGGCCCTCATCACCAGGGG + Intronic
1056018742 9:82420068-82420090 TACATGGCACTTAGCACAAGTGG - Intergenic
1056265290 9:84890696-84890718 ATCATGGCATTCATCCCAAGGGG - Intronic
1061850342 9:133411233-133411255 CACAAGGCACTTCTCCCAGGGGG - Intronic
1187105820 X:16240404-16240426 CACATGACTCTCATCCCCACAGG + Intergenic
1187671936 X:21676113-21676135 CACAGGGCTCTCACCCCAGGTGG + Intergenic
1195137782 X:101927748-101927770 TACATGGCATTCATTCCAACAGG + Intronic
1197902610 X:131390427-131390449 CACTTTGCAGTTATCCCAAGGGG - Intronic
1198519974 X:137442550-137442572 GACATGGCATTCATCCCATCTGG + Intergenic