ID: 1024563500

View in Genome Browser
Species Human (GRCh38)
Location 7:50663460-50663482
Sequence GGGATGAGTGCCATGTGACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 134}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024563489_1024563500 22 Left 1024563489 7:50663415-50663437 CCTTTGCCTCCTGCCACAGCCTC 0: 1
1: 0
2: 35
3: 217
4: 1005
Right 1024563500 7:50663460-50663482 GGGATGAGTGCCATGTGACTAGG 0: 1
1: 0
2: 1
3: 11
4: 134
1024563496_1024563500 -4 Left 1024563496 7:50663441-50663463 CCATCGAGTCCCTCCACTTGGGA 0: 1
1: 0
2: 0
3: 4
4: 122
Right 1024563500 7:50663460-50663482 GGGATGAGTGCCATGTGACTAGG 0: 1
1: 0
2: 1
3: 11
4: 134
1024563492_1024563500 9 Left 1024563492 7:50663428-50663450 CCACAGCCTCTCACCATCGAGTC 0: 1
1: 0
2: 0
3: 12
4: 220
Right 1024563500 7:50663460-50663482 GGGATGAGTGCCATGTGACTAGG 0: 1
1: 0
2: 1
3: 11
4: 134
1024563490_1024563500 16 Left 1024563490 7:50663421-50663443 CCTCCTGCCACAGCCTCTCACCA 0: 1
1: 1
2: 28
3: 438
4: 6434
Right 1024563500 7:50663460-50663482 GGGATGAGTGCCATGTGACTAGG 0: 1
1: 0
2: 1
3: 11
4: 134
1024563491_1024563500 13 Left 1024563491 7:50663424-50663446 CCTGCCACAGCCTCTCACCATCG 0: 1
1: 0
2: 1
3: 36
4: 381
Right 1024563500 7:50663460-50663482 GGGATGAGTGCCATGTGACTAGG 0: 1
1: 0
2: 1
3: 11
4: 134
1024563493_1024563500 3 Left 1024563493 7:50663434-50663456 CCTCTCACCATCGAGTCCCTCCA 0: 1
1: 0
2: 1
3: 13
4: 168
Right 1024563500 7:50663460-50663482 GGGATGAGTGCCATGTGACTAGG 0: 1
1: 0
2: 1
3: 11
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024563500 Original CRISPR GGGATGAGTGCCATGTGACT AGG Intronic
900401758 1:2475623-2475645 GGGATGACAGCCATCTGACCTGG - Intronic
900509287 1:3050960-3050982 GGCCAGAGTGCCCTGTGACTTGG + Intergenic
900868896 1:5287943-5287965 GGGGTGAGTCCAGTGTGACTGGG - Intergenic
904301461 1:29557313-29557335 GGGATCAGTGCCTTGAGACATGG + Intergenic
906127935 1:43439090-43439112 GAGATGAGTGCCATCTCACTTGG - Exonic
911345576 1:96692875-96692897 GGGATGAGTGTCAGGAGAGTGGG - Intergenic
913069218 1:115284459-115284481 GGCATGAGAGCCATTTGATTAGG - Intergenic
916265678 1:162888026-162888048 GGGATGAGTGGCAAGGGATTGGG - Intergenic
916764745 1:167849492-167849514 TAGATGAGTGCCATGTGATTGGG + Intronic
1062947465 10:1472424-1472446 GGGGCGAGTGCCATGCGGCTCGG + Intronic
1064020288 10:11803776-11803798 GGGGTGAGTGGCAGGTGACTGGG - Intergenic
1065454326 10:25891499-25891521 AAGAGGAATGCCATGTGACTAGG + Intergenic
1067272411 10:44803768-44803790 GGCATGATTGTCATGTGGCTAGG - Intergenic
1073867409 10:107820679-107820701 AGGAAGAATGCCATGTGAGTAGG + Intergenic
1074382977 10:112995225-112995247 GGGATGATTGACTTGGGACTGGG + Intronic
1075791510 10:125087582-125087604 GGGATGAGAGACATGTGAGTGGG - Intronic
1076466533 10:130686379-130686401 GGCCTGAGGGCCATGTGACCTGG + Intergenic
1076905994 10:133361418-133361440 GGGATTAGTGCCCTGTGAGAGGG - Intergenic
1083402618 11:62434461-62434483 GGGATGAGTTGGGTGTGACTCGG - Intronic
1085044691 11:73346048-73346070 GGGATGAGCACCCTGTGCCTGGG + Intronic
1085402001 11:76241046-76241068 GGGCTGAGTCCCATTTGGCTGGG + Intergenic
1085499389 11:77005678-77005700 GGGGAGAATGCCATGTGACAAGG - Intronic
1085595969 11:77810287-77810309 AGGATGGGAGCCATGTGACATGG - Intronic
1086063628 11:82724732-82724754 GAGAAGACGGCCATGTGACTAGG - Intergenic
1090985946 11:131766287-131766309 GAGATGGGTGCTATGTCACTTGG - Intronic
1092454651 12:8632477-8632499 GTGAAGAGTTCCATGTGATTTGG - Intergenic
1092642886 12:10536750-10536772 GGACTCAGTTCCATGTGACTGGG + Intergenic
1095522745 12:43086256-43086278 GGACTCAGTTCCATGTGACTGGG - Intergenic
1096637970 12:52973363-52973385 GGGATGAGGGCCCTGGGAATGGG + Intergenic
1096829308 12:54301715-54301737 GAGTTGGGTGCCATGTGGCTGGG - Intronic
1099405059 12:82249274-82249296 GGGATTAGTGCCATTTTACCAGG + Intronic
1102410372 12:112712582-112712604 GGCATGAGGGACATGTGATTGGG - Intronic
1103263646 12:119610639-119610661 AGAATGAGTGCCAAGTGAATTGG - Intronic
1108303835 13:49110248-49110270 GTGATGACTGTCACGTGACTCGG + Intronic
1114405815 14:22455159-22455181 GGGATGAATATCATGTGACTTGG + Intergenic
1117615619 14:57531092-57531114 GGAATCAGTGCAAGGTGACTTGG - Intergenic
1117658149 14:57977658-57977680 AGGTTAAGTGCCATGAGACTTGG - Intronic
1118255054 14:64198588-64198610 TGGATGAGTGCTTTGTCACTTGG + Intronic
1118608507 14:67521283-67521305 GGAATGAGTGCATTGTGACAGGG + Intronic
1119050388 14:71362084-71362106 ATGGTGAGTGCCATGTGGCTGGG + Intronic
1119616503 14:76102310-76102332 GGGATGTGTGCCCTGTGCCAAGG - Intergenic
1121136628 14:91504745-91504767 AGGTTGAGTGCCAAGTTACTCGG + Intronic
1122207403 14:100154869-100154891 GGGTGGAGTGGCCTGTGACTGGG - Intronic
1124063482 15:26318052-26318074 GGAATGAGTGACATGTGAGAAGG + Intergenic
1125746954 15:42003821-42003843 GGGCAGAGTGCCCTGTAACTGGG - Intronic
1128048297 15:64639516-64639538 GGGAAGACAGCCATGTGACTGGG - Intronic
1131954190 15:97714093-97714115 GGGATGTGTGCCACCAGACTAGG - Intergenic
1138482441 16:57312477-57312499 GGCATTAGTGCCATGTGGGTGGG + Intergenic
1141095422 16:81159642-81159664 GGGATGAGGTCCAGGAGACTTGG - Intergenic
1141495558 16:84407182-84407204 GTGATGAGTTCCCTGTCACTGGG - Intronic
1143205156 17:5136101-5136123 GGGATGAAAGGCATCTGACTTGG - Intronic
1144476260 17:15591624-15591646 GGAGTGAGTGCCATGTACCTAGG + Intronic
1144876207 17:18398793-18398815 GGGATGAAAGGCATTTGACTTGG - Intergenic
1145156021 17:20545627-20545649 GGGATGAAAGGCATTTGACTTGG + Intergenic
1145275211 17:21425011-21425033 GGGAGGAGGGCCCTGGGACTGGG + Intergenic
1145313066 17:21710908-21710930 GGGAGGAGGGCCCTGGGACTGGG + Intergenic
1145711486 17:26982714-26982736 GGGAGGAGGGCCCTGGGACTAGG + Intergenic
1148656744 17:49289821-49289843 AGGATGAAGGCCATGTGGCTGGG - Intronic
1148893358 17:50823953-50823975 GGGTGGAGTGTCATGTGACTTGG + Intergenic
1152687241 17:81700664-81700686 GGAATGAGTGCCATGGGAGAAGG - Intronic
1155333952 18:24746100-24746122 GGCATGGATGCCATGTGACCTGG + Intergenic
1157308863 18:46536984-46537006 GGGAGGAGTGTGATGTAACTTGG - Intronic
1162906478 19:13826897-13826919 GGTGTGAGTGCCATGGGACCTGG + Intronic
1163293132 19:16393836-16393858 GGGATGGCAGCCATGTAACTGGG - Intronic
1164098782 19:22035751-22035773 GGCATGAGAGCCTTGTGCCTGGG - Intergenic
1165429564 19:35764856-35764878 GGGATGAGTTCCATGTGTGGAGG - Exonic
1165990265 19:39807467-39807489 GGGATGAAAGCCATTTTACTTGG - Intergenic
1166153032 19:40888354-40888376 AGAAGGAGGGCCATGTGACTAGG + Intronic
1166661452 19:44649906-44649928 GGTCTGAGTGCCAGGTGATTTGG - Exonic
1166841118 19:45697680-45697702 GGGATGTTTGCCATGAGAATGGG - Intronic
1168164080 19:54534489-54534511 GGGATGAGTGTCACGAGACTGGG - Intronic
924984794 2:260908-260930 GGGAAGAGAGCCATTGGACTTGG + Intronic
925771227 2:7284909-7284931 GGGTTGATTTCCATGTGAATGGG + Intergenic
929706725 2:44220734-44220756 GTGACCATTGCCATGTGACTTGG + Intronic
933548585 2:83744705-83744727 GGGATGAGTGCAAAGTGACCTGG + Intergenic
937311412 2:120905573-120905595 GGGATGAGTTCTCTGTGTCTGGG + Intronic
939667408 2:144968654-144968676 AGGATGAGTGCCAAGTGAAAGGG + Intergenic
941160185 2:162026619-162026641 GTGATGAGTGCAATGAGACCTGG - Intronic
946417596 2:219548133-219548155 GGGTTGGGGGCCAAGTGACTGGG + Intronic
947582979 2:231333104-231333126 GAGATGAGGGCCAGGTGACCAGG - Intronic
948098608 2:235356500-235356522 GTTATGAGTGACATGTGTCTGGG + Intergenic
1170693777 20:18638794-18638816 GGGATGTGTGGCTTGTGACAGGG + Intronic
1173552682 20:43944121-43944143 GAGACGAGTGTCATGTGCCTTGG + Intronic
1173642758 20:44615341-44615363 GTGATGAGGGTCATGTGATTGGG - Intronic
1175462719 20:59165165-59165187 AGGAGGAGTGCCATGTGAGCAGG + Intergenic
1176427887 21:6559992-6560014 GGGATGATGGCCATGGGGCTGGG + Intergenic
1177792333 21:25734844-25734866 GGACTGAGTGCAAGGTGACTGGG - Exonic
1180027126 21:45172438-45172460 ATGATGAGTGACATGTCACTGGG + Intronic
1180581753 22:16845119-16845141 GGGAGGAGTGCCATGCCACAGGG + Intergenic
1182445655 22:30387781-30387803 GGGAAGAGAGGGATGTGACTTGG - Intronic
1182739563 22:32557734-32557756 GGGCAGAGTGGCATGTGACGAGG - Intronic
1184678925 22:46059315-46059337 GGGGTTAGTGCCAAGTGGCTTGG + Intronic
1184750811 22:46485467-46485489 GGGAGGAGGCCCATGTGCCTGGG + Intronic
949382001 3:3457005-3457027 GAGGTGGGGGCCATGTGACTAGG + Intergenic
954636887 3:52075815-52075837 GGGATTTGTACCATGGGACTTGG - Exonic
960811877 3:121633886-121633908 GGGATGAGTTCCATTTGAATTGG - Intronic
962977187 3:140456026-140456048 AGGTGGAGTCCCATGTGACTAGG + Intronic
964507703 3:157417625-157417647 GTGATCAGTGCCATGTAGCTGGG - Intronic
967182429 3:186918004-186918026 GAGATGAGTGCCTGGAGACTAGG + Intergenic
967815107 3:193791840-193791862 GGGCTGAGTGCCCTGAGACAGGG - Intergenic
968816598 4:2824746-2824768 AGGACGAGTGCAAGGTGACTGGG + Intronic
969028250 4:4191499-4191521 GGGCTGCGTGCCATGTGGGTGGG - Intronic
973644787 4:52939657-52939679 GTGATAAGAGCCATTTGACTAGG + Intronic
975523565 4:75325800-75325822 GGGCTGATTGCAATTTGACTGGG - Intergenic
976202029 4:82588447-82588469 GGGGTGGGTGCCATGTGCCCTGG + Intergenic
976891293 4:90050827-90050849 AGGATGAGTACCCTGGGACTTGG + Intergenic
987666402 5:20946774-20946796 GGGATGAGAGCCAAGTGAAACGG - Intergenic
987712746 5:21523530-21523552 GTGATGTTGGCCATGTGACTAGG - Intergenic
993517408 5:88855696-88855718 AGAATGAGTGCCAAGTGAATGGG - Intronic
997413829 5:133710077-133710099 GGGAGGAGTGCCATGAGGCAGGG + Intergenic
997782586 5:136675172-136675194 GGAATGAGTGAGATGTGGCTTGG + Intergenic
999885629 5:155919908-155919930 GGGAGGAGAGACATGTGACAGGG + Intronic
1000379658 5:160617318-160617340 GGGCTGAGTGCAATGTGATAGGG + Intronic
1001245584 5:170104028-170104050 AGGATGAGTTCCAGGTAACTGGG - Intergenic
1009003973 6:57758389-57758411 GTGATGTTGGCCATGTGACTAGG + Intergenic
1010202417 6:73294619-73294641 TGGATGAGTGGCATGTTGCTAGG - Intronic
1011795087 6:90944086-90944108 AGGAAGAGTGGCATGTGATTGGG + Intergenic
1013015890 6:106160275-106160297 AGGGTGAGTTACATGTGACTTGG - Intergenic
1018601052 6:165541237-165541259 CGGCTGAGTGAGATGTGACTTGG - Intronic
1020358121 7:7299977-7299999 AGGATCAGTGCCATGTTTCTTGG + Intergenic
1021421431 7:20449468-20449490 GGGATGAAACTCATGTGACTGGG - Intergenic
1023805306 7:43869142-43869164 GGGAACAGTGCCAGCTGACTGGG - Intronic
1023889332 7:44381359-44381381 GGGAGGAGCGCAAAGTGACTGGG + Exonic
1024139330 7:46445957-46445979 GGGAAGATTTCCATGTCACTCGG + Intergenic
1024563500 7:50663460-50663482 GGGATGAGTGCCATGTGACTAGG + Intronic
1025147286 7:56515720-56515742 GGGATGAGGGCCAGGGGTCTTGG + Intergenic
1026909011 7:74081830-74081852 GGAATGAGAGCCTTGTAACTTGG - Intergenic
1029562915 7:101315581-101315603 GGGATGTGTGTTATGTGAATTGG + Intronic
1036548296 8:9793316-9793338 GGGATTTGGGCCATGTGAATAGG - Intergenic
1036677772 8:10849496-10849518 AGAATGAGTGCCATGAGGCTGGG - Intergenic
1043196200 8:77295441-77295463 GGTATGACTGCCCTGAGACTTGG + Intergenic
1044029043 8:87211525-87211547 GGGGTGGGTCCCTTGTGACTTGG + Intronic
1044375764 8:91468468-91468490 GAGATGACTGACATGTGGCTTGG + Intergenic
1047603342 8:126449671-126449693 GGGTTGAGGGCCATTTGCCTGGG + Intergenic
1047643182 8:126842596-126842618 GGGGAGAGAGTCATGTGACTTGG + Intergenic
1048737114 8:137514201-137514223 GGGAGGACAGACATGTGACTCGG + Intergenic
1052272124 9:26637862-26637884 GGGATGATTGACCTTTGACTTGG - Intergenic
1052673892 9:31594320-31594342 GAGATGATTGCCTTGAGACTAGG + Intergenic
1056753913 9:89370887-89370909 GGGATGTGTGGCATGTGACTGGG + Intronic
1060478798 9:124005176-124005198 GGGAGGGGTGCCAAGGGACTGGG + Intronic
1060743384 9:126114067-126114089 GTGATGAGTGCCCTGTGGCTGGG + Intergenic
1062009445 9:134259210-134259232 GGGATGAGGGCCAGGGGCCTGGG - Intergenic
1062159987 9:135074885-135074907 GGGCTGCGTGCCAGGTGACCAGG + Intergenic
1203442935 Un_GL000219v1:28334-28356 GGGAAGAGTGACTTGTAACTGGG - Intergenic
1203513743 Un_KI270741v1:147243-147265 GGGAAGAGTGACTTGTAACTGGG - Intergenic
1192397178 X:70794310-70794332 TGGATGATTGCCCTCTGACTAGG - Intronic
1198263073 X:134983819-134983841 GGGATCAGTGCCTTGTGAAAGGG + Intergenic