ID: 1024563501

View in Genome Browser
Species Human (GRCh38)
Location 7:50663461-50663483
Sequence GGATGAGTGCCATGTGACTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024563490_1024563501 17 Left 1024563490 7:50663421-50663443 CCTCCTGCCACAGCCTCTCACCA 0: 1
1: 1
2: 28
3: 438
4: 6434
Right 1024563501 7:50663461-50663483 GGATGAGTGCCATGTGACTAGGG No data
1024563492_1024563501 10 Left 1024563492 7:50663428-50663450 CCACAGCCTCTCACCATCGAGTC 0: 1
1: 0
2: 0
3: 12
4: 220
Right 1024563501 7:50663461-50663483 GGATGAGTGCCATGTGACTAGGG No data
1024563496_1024563501 -3 Left 1024563496 7:50663441-50663463 CCATCGAGTCCCTCCACTTGGGA 0: 1
1: 0
2: 0
3: 4
4: 122
Right 1024563501 7:50663461-50663483 GGATGAGTGCCATGTGACTAGGG No data
1024563489_1024563501 23 Left 1024563489 7:50663415-50663437 CCTTTGCCTCCTGCCACAGCCTC 0: 1
1: 0
2: 35
3: 217
4: 1005
Right 1024563501 7:50663461-50663483 GGATGAGTGCCATGTGACTAGGG No data
1024563493_1024563501 4 Left 1024563493 7:50663434-50663456 CCTCTCACCATCGAGTCCCTCCA 0: 1
1: 0
2: 1
3: 13
4: 168
Right 1024563501 7:50663461-50663483 GGATGAGTGCCATGTGACTAGGG No data
1024563491_1024563501 14 Left 1024563491 7:50663424-50663446 CCTGCCACAGCCTCTCACCATCG 0: 1
1: 0
2: 1
3: 36
4: 381
Right 1024563501 7:50663461-50663483 GGATGAGTGCCATGTGACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024563501 Original CRISPR GGATGAGTGCCATGTGACTA GGG Intronic
No off target data available for this crispr