ID: 1024563504

View in Genome Browser
Species Human (GRCh38)
Location 7:50663475-50663497
Sequence TGACTAGGGTCCTTCTCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 218}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024563497_1024563504 2 Left 1024563497 7:50663450-50663472 CCCTCCACTTGGGATGAGTGCCA 0: 1
1: 0
2: 0
3: 11
4: 97
Right 1024563504 7:50663475-50663497 TGACTAGGGTCCTTCTCACAGGG 0: 1
1: 0
2: 2
3: 22
4: 218
1024563496_1024563504 11 Left 1024563496 7:50663441-50663463 CCATCGAGTCCCTCCACTTGGGA 0: 1
1: 0
2: 0
3: 4
4: 122
Right 1024563504 7:50663475-50663497 TGACTAGGGTCCTTCTCACAGGG 0: 1
1: 0
2: 2
3: 22
4: 218
1024563491_1024563504 28 Left 1024563491 7:50663424-50663446 CCTGCCACAGCCTCTCACCATCG 0: 1
1: 0
2: 1
3: 36
4: 381
Right 1024563504 7:50663475-50663497 TGACTAGGGTCCTTCTCACAGGG 0: 1
1: 0
2: 2
3: 22
4: 218
1024563492_1024563504 24 Left 1024563492 7:50663428-50663450 CCACAGCCTCTCACCATCGAGTC 0: 1
1: 0
2: 0
3: 12
4: 220
Right 1024563504 7:50663475-50663497 TGACTAGGGTCCTTCTCACAGGG 0: 1
1: 0
2: 2
3: 22
4: 218
1024563499_1024563504 -2 Left 1024563499 7:50663454-50663476 CCACTTGGGATGAGTGCCATGTG 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1024563504 7:50663475-50663497 TGACTAGGGTCCTTCTCACAGGG 0: 1
1: 0
2: 2
3: 22
4: 218
1024563498_1024563504 1 Left 1024563498 7:50663451-50663473 CCTCCACTTGGGATGAGTGCCAT 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1024563504 7:50663475-50663497 TGACTAGGGTCCTTCTCACAGGG 0: 1
1: 0
2: 2
3: 22
4: 218
1024563493_1024563504 18 Left 1024563493 7:50663434-50663456 CCTCTCACCATCGAGTCCCTCCA 0: 1
1: 0
2: 1
3: 13
4: 168
Right 1024563504 7:50663475-50663497 TGACTAGGGTCCTTCTCACAGGG 0: 1
1: 0
2: 2
3: 22
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024563504 Original CRISPR TGACTAGGGTCCTTCTCACA GGG Intronic
900463281 1:2811399-2811421 GGATTAAGGTCCTTGTCACAGGG + Intergenic
900853012 1:5158481-5158503 TGACTGGGGTCCTTCTAAATAGG - Intergenic
900926156 1:5707464-5707486 TGACTAGCATCCTTATCAAAAGG + Intergenic
904562241 1:31406686-31406708 TGTCTAGGGTCATTCTAACAGGG + Intergenic
907321017 1:53602434-53602456 TCACCAGGGTCTTTCTCCCAGGG + Intronic
908348207 1:63257795-63257817 TGACAAGGCTCCTACCCACAAGG - Intergenic
908390678 1:63680864-63680886 TGACTGGTGTCCTTCTAAAAAGG + Intergenic
908427132 1:64018114-64018136 GGACTAGGGTCCTGCTCACAGGG + Intronic
912366249 1:109136262-109136284 TGACCAGGGTCCTTATAAAAAGG + Intronic
915824353 1:159058748-159058770 AGACAGGGGTCCTTATCACATGG + Intergenic
917500932 1:175584209-175584231 TGACTGGTGTCCTTATCAAAAGG + Intronic
917526153 1:175790150-175790172 TGACTTGGTTCCTTTTCACAGGG + Intergenic
919228484 1:194740005-194740027 TGAATGGGATCATTCTCACAGGG + Intergenic
919507209 1:198414150-198414172 TGTCTATGTTCCTTATCACAAGG + Intergenic
920272084 1:204773280-204773302 TGGCCAGTGTCCTTCTCCCAAGG + Intergenic
921265984 1:213420975-213420997 TGACTGGTGTCCTTATCAGAAGG - Intergenic
921511426 1:216035282-216035304 TGACTAGTGTCCTTATAAAAAGG + Intronic
922002529 1:221494612-221494634 AGACGGGGGTCCTTATCACACGG + Intergenic
922710687 1:227828729-227828751 TGATTCTGTTCCTTCTCACAAGG + Intronic
924326387 1:242898548-242898570 TGACTAGTGTCCTTATAAAAAGG - Intergenic
924846126 1:247774071-247774093 TCACTAAGGTCCTTCTAAGAGGG + Intergenic
1064712046 10:18138362-18138384 TGATTATGGTCATTCTTACAGGG + Intergenic
1064785759 10:18892640-18892662 TGACTAGAGTCCTTGTAAGAAGG + Intergenic
1066192705 10:33070458-33070480 TGATTAGTGTCCTTATCAAAAGG - Intergenic
1066416469 10:35226289-35226311 TCACTAGGGTCCTTCTAGGAGGG + Intergenic
1070497577 10:77038407-77038429 TGACAAGGATTCTTCTCACTGGG - Intronic
1071974877 10:90945455-90945477 TGACTAGTGTCCTTATCCAAAGG - Intergenic
1072764015 10:98081465-98081487 TGATTAGTGGCCTTCTCTCACGG + Intergenic
1073542086 10:104322841-104322863 TGACTTGGGTCCCTTTCACTAGG + Intronic
1073665845 10:105533014-105533036 TGACTAGTATCCTTCTAAAAAGG + Intergenic
1073916977 10:108417075-108417097 TGACCAGAGTCCTTCCCAAATGG + Intergenic
1075289458 10:121215837-121215859 TGACTAGCGTCCTTGTAAAAGGG + Intergenic
1075682805 10:124344351-124344373 TGAGTGGGGTCCTTCTCACAGGG + Intergenic
1076337717 10:129719634-129719656 TGACTGGTGTCCTTCTAAGAAGG - Intronic
1076531538 10:131148221-131148243 TCACAAGGGTCCTTCTAAGAGGG + Intronic
1077447228 11:2602021-2602043 TCACAAGGGTCCTTATAACAGGG + Intronic
1077482416 11:2822004-2822026 TCACAAGGGTCCTTCTAAGAGGG + Intronic
1078025335 11:7689691-7689713 TGACTAGTGTCCTTATTAAAAGG - Intronic
1082083998 11:48034047-48034069 TGAGTGGAGTCCTTCTCACTTGG + Intronic
1083086837 11:60157325-60157347 TGAGTTAAGTCCTTCTCACAAGG + Intergenic
1084255828 11:67941922-67941944 TCACTATGGTTCTTCTCTCATGG - Intergenic
1084358757 11:68656243-68656265 TGACTTGTGTCCTTCTAAGAGGG + Intergenic
1084385076 11:68838534-68838556 AGAGTAGAGTCCTTCTCACTTGG - Intronic
1084816931 11:71653405-71653427 TCACTATGGTTCTTCTCTCATGG + Intergenic
1085452200 11:76641183-76641205 TGACTAGTGTCCTTGTAAAAAGG + Intergenic
1085758866 11:79224639-79224661 TGACTAGTGTCCTTATAAAAAGG + Intronic
1086814301 11:91349434-91349456 TGACTAGTGTCCTTATAAGAAGG + Intergenic
1087004245 11:93453532-93453554 TGACTAGTGTCCTTATAAAAGGG + Intergenic
1087081375 11:94174106-94174128 TGACTTGTGTCCTTATCAGAAGG - Intronic
1087133584 11:94692307-94692329 AGACTAGTGTCCTTGTCAAAAGG - Intergenic
1090790541 11:130089852-130089874 TGACTGGTGTCCTTCTGAGAAGG - Intronic
1096813574 12:54187172-54187194 TGACAATGGTCCTTGTCGCATGG - Intronic
1097805515 12:63960728-63960750 TCACAAGGGTCCTTATAACAGGG + Intronic
1098169878 12:67736608-67736630 TGACTGGTGTCCTTATAACAAGG + Intergenic
1100523544 12:95399314-95399336 TCACAAGGGTCCTTCTGAAAAGG + Intergenic
1100529610 12:95451528-95451550 TGAGTTTGGTCCTTCCCACAAGG + Intergenic
1101039163 12:100736724-100736746 TGACTAGTGTCCTTATAAGAAGG + Intronic
1101780192 12:107828313-107828335 TGAGTATGGTCCTTCCCATAAGG + Intergenic
1101978218 12:109381244-109381266 TGATTCGAGTCCTTCTGACATGG - Intronic
1104382055 12:128315756-128315778 TGACTGGGGTCCTTATGAGAAGG + Intronic
1104620929 12:130312348-130312370 TGATGAGGGTCCTTCTAAGAAGG - Intergenic
1104753303 12:131253442-131253464 AGTCTAGGTACCTTCTCACAGGG + Intergenic
1106299896 13:28453951-28453973 TGCCTAGGGTGCTTCCCAGAGGG + Intronic
1106589529 13:31087548-31087570 TGACTAGTGTCCTTATAAAATGG - Intergenic
1106951597 13:34890605-34890627 TGACTGGGGTCCTTGTAAAAAGG + Intergenic
1108115096 13:47118849-47118871 TGACTAGTGTCCTTATAAAAAGG + Intergenic
1108523314 13:51263626-51263648 TGACTTGCTTCCTTCTCAAAGGG - Intronic
1111570858 13:90083974-90083996 TGTCTAAGTTCCATCTCACATGG - Intergenic
1111653445 13:91122955-91122977 TGACTAGGGACTTTCCAACAAGG - Intergenic
1112795382 13:103050952-103050974 TGACTGGTGTCCTTATCAAAAGG + Intronic
1116510667 14:45742432-45742454 TGACTAGGGACTTTCCAACAAGG + Intergenic
1117623118 14:57608344-57608366 TGACCAGTGTCCTTCTAAAAAGG + Intronic
1117838812 14:59836087-59836109 TCACGAGGGTCCTTCTAAGAGGG - Intronic
1118305096 14:64649097-64649119 TGACTGGTGTCCTTCTAAGAAGG + Intergenic
1118320045 14:64747703-64747725 GAACTAAGGTCCTTCTCACGGGG + Exonic
1118973917 14:70661226-70661248 TGACTAGTGTCCTTATAAAAAGG - Intronic
1120749487 14:88184818-88184840 TGAGTTTGGTCTTTCTCACAGGG - Intronic
1121856635 14:97276330-97276352 TCACAAGGGTCCTTATCAGAGGG + Intergenic
1125118489 15:36123876-36123898 GGACTCAGGTCCTTCTCATAGGG - Intergenic
1125300384 15:38248726-38248748 TGACTAGCTTCCTTCCCACAGGG + Intergenic
1125563524 15:40657741-40657763 TGACTAGTGTCCTTATAAAAAGG - Intronic
1127373402 15:58360731-58360753 TGACTGGTGTCCTTCTGAAAGGG - Intronic
1128113369 15:65090280-65090302 TCACGAGGGTCCTTCTAAGAAGG + Intergenic
1128117322 15:65118021-65118043 TCATTAGGATCCTTCTAACATGG + Exonic
1128691093 15:69725509-69725531 GAACTAGGGGCCTTCCCACAAGG + Intergenic
1131359256 15:91775020-91775042 TGACTAGTGTCCTAATCACAAGG + Intergenic
1132155024 15:99489595-99489617 TCACTAGGGTCCTTATGAGAGGG - Intergenic
1132672616 16:1107962-1107984 TGACTAGCGTCCCTGTGACAGGG + Intergenic
1135923432 16:26671703-26671725 TGACTGGTGTCCTTCTAAAAAGG - Intergenic
1138173138 16:54871730-54871752 TGACTAGTGTCCTTATAAAAAGG + Intergenic
1140982522 16:80124645-80124667 AGAATACGGTCCATCTCACAGGG - Intergenic
1141410138 16:83827607-83827629 TGACTAGAGTCCTTCTAAGAAGG + Intergenic
1141689009 16:85586154-85586176 TGACTGGAGTCCTTCTAACAAGG - Intergenic
1143317604 17:6044358-6044380 TTACTAGTGTCCTTCTCCTAAGG + Intronic
1143987100 17:10924240-10924262 TGACTAGCATTCTCCTCACAAGG + Intergenic
1144118557 17:12126567-12126589 TGTCTGGGGTCTTTCTTACAAGG + Intronic
1145752472 17:27365147-27365169 TGATTAGTGTCCTTATAACAGGG + Intergenic
1145804649 17:27717817-27717839 CGAGTATGGTCCTTCCCACAAGG - Intergenic
1146024102 17:29304486-29304508 TCACTGGGGGTCTTCTCACAGGG + Intergenic
1147609229 17:41791959-41791981 TGACTCTGGTCCTTCTCCCCAGG + Intergenic
1148251992 17:46090082-46090104 TGACTGGTGTCCTCCTGACATGG + Intronic
1150861506 17:68805648-68805670 TGACTGGGGTCCTTATAAAAAGG + Intergenic
1151383688 17:73742471-73742493 TGACTGGTGTCCTTCTAAGAAGG + Intergenic
1151881437 17:76897556-76897578 TGACTGGGGTCCTTCTAAGAAGG - Intronic
1152261373 17:79269079-79269101 TCACTGGGGTCCTTCTGAGAAGG + Intronic
1153789574 18:8565419-8565441 TGGATAGCTTCCTTCTCACAAGG - Intergenic
1157597541 18:48872942-48872964 TGACTCAGGTCCTTCTGACAAGG + Intergenic
1159951649 18:74488455-74488477 TGACTGGTGTCCTTCTTACTAGG + Intergenic
1161789057 19:6347879-6347901 TGACTAGTGTCCTTATAAAAAGG + Intergenic
1163236419 19:16032922-16032944 TGACCAGGCTCCTTCTAACAAGG - Intergenic
1163778725 19:19233800-19233822 AGACAAGGGTTGTTCTCACAGGG - Exonic
1165094502 19:33402909-33402931 TGCCAAGGGTCCCTCTTACAGGG - Intronic
1167198472 19:48047290-48047312 TGACTAGTGTCCTTATGAAAAGG - Intergenic
1167255928 19:48428671-48428693 TGACTAGTGTCCTTATAAAAAGG - Intronic
925074846 2:1007227-1007249 TGTCTAATGTCCTTCTCACTAGG - Intronic
925461328 2:4065629-4065651 TGACTGGAGTCCTTATCAAAAGG + Intergenic
925794634 2:7528767-7528789 TGACAAGGGTCTTTCTAAGAGGG - Intergenic
925863514 2:8203037-8203059 TGACTAGTGTCCTTCTAAAAAGG - Intergenic
926307961 2:11653164-11653186 TGACTGGTGTCCTTCTAAGATGG + Intergenic
926314408 2:11698698-11698720 TGATTAGGGTCCTTCTCATGTGG + Intronic
926430860 2:12784587-12784609 TCAGTAGTGTCCTTCTCACGAGG - Intergenic
929572810 2:43033297-43033319 TCACAAGGGTCCTTCTGAAAGGG + Intergenic
930238556 2:48911599-48911621 GGACTGGGGTCCTTATCAAAAGG - Intergenic
930391773 2:50770467-50770489 GGACTAAGGTGCGTCTCACAGGG + Intronic
931115914 2:59166599-59166621 TGACTGGTGTCCTTATCAAAAGG + Intergenic
931849937 2:66242857-66242879 TGCCTAGGATCCTTCCAACAAGG - Intergenic
932449226 2:71798999-71799021 TGATAAGGGTCCTTCTCCCATGG - Intergenic
935727705 2:106038077-106038099 TCACAAGGGTCCTTATAACAGGG + Intergenic
935976195 2:108581315-108581337 TGACTAGGGGCTTTCCAACAAGG + Intronic
936968977 2:118156436-118156458 TGACTAGGGTGTTCCTCATATGG - Intergenic
938781193 2:134586493-134586515 TGACTAGCGTCCTTATGAAAAGG - Intronic
940963634 2:159813644-159813666 TGACTAGTGTCCTTATAAGAGGG - Intronic
942079310 2:172385214-172385236 TGAAGAGGGTCCCTCCCACATGG - Intergenic
943028578 2:182658388-182658410 TGACCAGTGTCCTTCTAATAAGG - Intergenic
945990962 2:216394949-216394971 TGACTAGTGTCCTTATAAAAAGG + Intergenic
946086518 2:217178967-217178989 TCACTATGGTCATTCTCATATGG + Intergenic
1169699650 20:8432099-8432121 AGACAGGGGTCCTTATCACATGG + Intronic
1170476695 20:16721991-16722013 TGACTAGTGTCCTTATAAGAAGG + Intergenic
1173061128 20:39662191-39662213 GAACTAGGGTACTCCTCACAGGG + Intergenic
1175507646 20:59497192-59497214 TGACTGGGGTCCTTATAAAAGGG - Intergenic
1177135647 21:17303305-17303327 TGAGTATGGTCCTTCCCACAAGG - Intergenic
1177374973 21:20258354-20258376 TGACCAGGGGGCTTTTCACACGG + Intergenic
1179635037 21:42703383-42703405 TCACCAGCGTCCTTCTCCCACGG - Intronic
1181842823 22:25679338-25679360 TGACTAGGGACAATCTCAAAAGG - Intronic
950112283 3:10426935-10426957 TCACGAGGGACCTTCTCTCATGG - Intronic
950750710 3:15125850-15125872 TCACTATGGTTCTTCTCTCATGG + Intergenic
954795537 3:53159793-53159815 TGAATATGGTCCTTCACTCAGGG + Intronic
954922522 3:54203956-54203978 TGGCTAGGGTCCCACTCCCAGGG - Intronic
955648648 3:61168513-61168535 TGACTTGGGTCTTCCTCACTGGG - Intronic
957070741 3:75565963-75565985 TCACTATGGTTCTTCTCTCATGG - Intergenic
960278896 3:115758841-115758863 TGACTAGGGTACATATGACATGG + Intergenic
961283355 3:125780605-125780627 TCACTATGGTTCTTCTCTCATGG + Intergenic
961958995 3:130834277-130834299 TGACTAGTGTCCTTATAAAAAGG - Intergenic
963652888 3:148006630-148006652 TGACTTGGTTCCTTACCACATGG - Intergenic
964476472 3:157102166-157102188 TGACTGGTGTCCTTATAACAAGG + Intergenic
964766662 3:160186101-160186123 TCACTAGGATCCTTGTGACATGG - Intergenic
966542160 3:181103946-181103968 TGACTAGGCTTCTTCTTATAGGG - Intergenic
969014348 4:4093628-4093650 TCACTATGGTTCTTCTCTCATGG - Intergenic
969623796 4:8292386-8292408 TTTCTGGGGTTCTTCTCACATGG + Intronic
969739616 4:9014793-9014815 TCACTATGGTTCTTCTCTCATGG + Intergenic
969798788 4:9546326-9546348 TCACTATGGTTCTTCTCTCATGG + Intergenic
970179442 4:13374725-13374747 TGACTTTGGTCTTTTTCACATGG + Intronic
970679402 4:18489609-18489631 TGAATAGAGTCCTCCTCACAGGG + Intergenic
972171721 4:36353604-36353626 TGATCAGGGTCCATCTCAGAAGG - Intergenic
972759049 4:42083860-42083882 TGACCAGGGACCTTTTAACAAGG - Intronic
977742220 4:100499668-100499690 TGCATGGGGTCCTTGTCACAAGG - Intronic
978468429 4:109034507-109034529 TGAAGAGGGACCTTGTCACATGG - Intronic
979962552 4:127037551-127037573 TGCCCAGGTTCCTTCTCACCTGG - Intergenic
981145745 4:141321959-141321981 TGACTAGTGTCCTTATAATAAGG - Intergenic
982830195 4:160049810-160049832 TGATTATGGACATTCTCACAGGG - Intergenic
985935509 5:3094478-3094500 TGACCAGTGTCCTTATCACAAGG - Intergenic
987550127 5:19368896-19368918 TGGCTAGGTTGCTTCTCACAGGG - Intergenic
987818430 5:22932532-22932554 TGAGTATAGTCCTTCCCACAAGG - Intergenic
991320281 5:65365727-65365749 TAAATAGGGTCCTTATAACAGGG - Intronic
992361416 5:76042077-76042099 TGTCCAGGGTGCTGCTCACAGGG + Intergenic
992615375 5:78542000-78542022 TGACAAGGGTCCATTTCAAAAGG + Intronic
994667834 5:102728172-102728194 TCACTAGGGTCCTTATAACAGGG + Intergenic
996565246 5:124873186-124873208 TGAATAAGGTGCTTCTCAGAAGG - Intergenic
998890701 5:146742793-146742815 TGACTAGTGTCCTTATAAAAAGG + Intronic
999122942 5:149223852-149223874 AGGCTAGGCTCCATCTCACAAGG + Intronic
999200879 5:149815312-149815334 TGGCTAGTGTCCTTATCAAAAGG + Intronic
1000193588 5:158937183-158937205 TGTCCAGAGTCCTTATCACAGGG + Intronic
1000748503 5:165065832-165065854 TGACTGGGGTCCTTATAAAAAGG - Intergenic
1001307710 5:170587701-170587723 TCACAAGGGTCTTTCTCAGAAGG - Intronic
1003939180 6:11007356-11007378 TGACTAGTGTCCTTATAAGAAGG + Intronic
1003946864 6:11084056-11084078 TGACTAGTGTCCTTATAAGAAGG + Intergenic
1004531964 6:16462171-16462193 TGAGTATGGTCCTTCCCACAAGG - Intronic
1005147119 6:22704253-22704275 AGACTATGGTCCTTTTCTCAGGG + Intergenic
1006459074 6:34147760-34147782 TGACTGGGGCCCTACTTACAAGG + Intronic
1010717436 6:79245823-79245845 TGAGTTGAGTCCTTTTCACATGG - Intergenic
1010912030 6:81570348-81570370 TGACTAGTGTCCTTATAAGAAGG + Intronic
1011224666 6:85093521-85093543 TGAGTATGGTCCTTCCCACAAGG - Intergenic
1011490182 6:87883508-87883530 TGACTAGTGTCCTTATAAAAAGG + Intergenic
1014202827 6:118623915-118623937 TGAGTATGGTCCCTCCCACAAGG - Intronic
1014365957 6:120542201-120542223 TGACTAGTGTCCTTATAAAAAGG - Intergenic
1015803130 6:137080747-137080769 AGACAGGGGTCCTTATCACACGG + Intergenic
1016035387 6:139377924-139377946 GGACTAGAGTCCTTGTCAAAAGG - Intergenic
1016035645 6:139380182-139380204 CAACTGGGGTCATTCTCACAGGG + Intergenic
1016582204 6:145641310-145641332 TGACTAGTGTCCTTATAAGAGGG + Intronic
1016697818 6:147018167-147018189 TGACTGGTGTCCTTGTGACAAGG - Intergenic
1017580939 6:155864702-155864724 TGCCTAGGTTTCTTCTCATAAGG + Intergenic
1017744380 6:157433768-157433790 TGACGAGTGTCCTTTTCAAATGG + Intronic
1017751959 6:157496531-157496553 TGACTAGTGCCCTTATCAAAAGG + Intronic
1019348139 7:540473-540495 TGACAAGACTCCTTCTCACTCGG + Intergenic
1021566553 7:22022429-22022451 TGACTGGTGTCCTTCTAAAAAGG + Intergenic
1021653445 7:22853400-22853422 TGACTGATGTCCTTATCACACGG - Intergenic
1022585108 7:31601469-31601491 TGACCAGGGGCATTCTCTCAAGG - Intronic
1023127747 7:36972632-36972654 TGACTAGTGTCCTTATAAAAAGG - Intronic
1023519850 7:41039347-41039369 TGTCTGGGGTCCCTCACACAGGG - Intergenic
1024563504 7:50663475-50663497 TGACTAGGGTCCTTCTCACAGGG + Intronic
1031541813 7:123004397-123004419 TGACTAGGTACCTGCTCCCAGGG - Intergenic
1036256071 8:7207713-7207735 TTACTATGGTTCTTCTCTCATGG - Intergenic
1036361414 8:8079786-8079808 TTACTATGGTTCTTCTCTCATGG + Intergenic
1037355496 8:18015492-18015514 TGACTAGGGACTTTCTGAGAAGG + Intronic
1037535679 8:19821606-19821628 TGACTAGTGTCCTTATAACATGG - Intronic
1043845703 8:85161149-85161171 TGACTAGTGTCCTTATAAGAAGG + Intergenic
1045356306 8:101392262-101392284 TGCCTAAGGCCCTTCCCACAGGG + Intergenic
1047032806 8:120901396-120901418 TGATTATGGCCATTCTCACAGGG - Intergenic
1051126635 9:13812585-13812607 TGACTGGGGACCTGCTAACAAGG + Intergenic
1052421980 9:28254075-28254097 AGACGGGGGTCCTTGTCACACGG - Intronic
1053484237 9:38439834-38439856 TGGTCAGGGTCCTTCTCACAGGG + Intergenic
1053666575 9:40321883-40321905 TGACCAGGGTCCCACTGACAAGG - Intronic
1053916161 9:42946929-42946951 TGACCAGGGTCCCACTGACAAGG - Intergenic
1054518034 9:66054400-66054422 TGACCAGGGTCCCACTGACAAGG + Intergenic
1054857683 9:69918611-69918633 TGACTGGTGTCCTTATAACAAGG - Intergenic
1056634966 9:88324022-88324044 TTACTGTGGTTCTTCTCACAGGG - Intergenic
1061905603 9:133695150-133695172 TGACTGCTGTCCTTCTAACACGG + Intronic
1061990304 9:134155054-134155076 TGACTCGGGTCATCCTCAAAAGG - Intronic
1062154378 9:135038463-135038485 TGGCTCCGATCCTTCTCACACGG + Intergenic
1062533858 9:137013121-137013143 TGTCTGGAGTCCTTCACACAGGG - Exonic
1186113314 X:6278267-6278289 TGACCAGGGTCCTTATAAAAAGG - Intergenic
1186518687 X:10186457-10186479 TGTGTAGGGGCCTGCTCACAAGG + Intronic
1186600951 X:11036556-11036578 TGCCTGGGGTCCTTCTCTAAGGG + Intergenic
1189505000 X:41604349-41604371 TGACTGGTGTCCTTCTAAGAAGG + Intronic
1189961565 X:46329442-46329464 TGACTAGTGTCCTTATAAAAAGG + Intergenic
1193283694 X:79686393-79686415 GGACTAGGTTCTTTCTCTCAAGG + Intergenic
1195222886 X:102763192-102763214 TGACCAAGCTCCTTCTCAAAGGG - Intergenic
1195738611 X:108039126-108039148 TAACTAGGATACTTCACACATGG + Intergenic
1196053933 X:111334880-111334902 TGACTAGGGTCATTTGGACATGG - Intronic
1197878086 X:131132971-131132993 TGACCAGTGTCCTTATCAAAAGG + Intergenic
1200865227 Y:8036376-8036398 CCACCAGGGTCCTTCTCACAAGG + Intergenic
1200902001 Y:8442106-8442128 CCACCAGGGTCCTTCCCACAAGG - Intergenic
1201223823 Y:11797102-11797124 TGACTAGTGTCCTTATAAAAAGG - Intergenic