ID: 1024563505

View in Genome Browser
Species Human (GRCh38)
Location 7:50663482-50663504
Sequence GGTCCTTCTCACAGGGATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024563499_1024563505 5 Left 1024563499 7:50663454-50663476 CCACTTGGGATGAGTGCCATGTG 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1024563505 7:50663482-50663504 GGTCCTTCTCACAGGGATAATGG No data
1024563493_1024563505 25 Left 1024563493 7:50663434-50663456 CCTCTCACCATCGAGTCCCTCCA 0: 1
1: 0
2: 1
3: 13
4: 168
Right 1024563505 7:50663482-50663504 GGTCCTTCTCACAGGGATAATGG No data
1024563496_1024563505 18 Left 1024563496 7:50663441-50663463 CCATCGAGTCCCTCCACTTGGGA 0: 1
1: 0
2: 0
3: 4
4: 122
Right 1024563505 7:50663482-50663504 GGTCCTTCTCACAGGGATAATGG No data
1024563498_1024563505 8 Left 1024563498 7:50663451-50663473 CCTCCACTTGGGATGAGTGCCAT 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1024563505 7:50663482-50663504 GGTCCTTCTCACAGGGATAATGG No data
1024563497_1024563505 9 Left 1024563497 7:50663450-50663472 CCCTCCACTTGGGATGAGTGCCA 0: 1
1: 0
2: 0
3: 11
4: 97
Right 1024563505 7:50663482-50663504 GGTCCTTCTCACAGGGATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024563505 Original CRISPR GGTCCTTCTCACAGGGATAA TGG Intronic
No off target data available for this crispr