ID: 1024566103

View in Genome Browser
Species Human (GRCh38)
Location 7:50682146-50682168
Sequence GAATCCAGAGACTCTTGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 188}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024566091_1024566103 24 Left 1024566091 7:50682099-50682121 CCACCTTGGGAACCAAGATATTG 0: 1
1: 0
2: 0
3: 6
4: 118
Right 1024566103 7:50682146-50682168 GAATCCAGAGACTCTTGAGAAGG 0: 1
1: 0
2: 0
3: 17
4: 188
1024566102_1024566103 -7 Left 1024566102 7:50682130-50682152 CCTGAAGGGCATAAGGGAATCCA 0: 1
1: 0
2: 0
3: 8
4: 123
Right 1024566103 7:50682146-50682168 GAATCCAGAGACTCTTGAGAAGG 0: 1
1: 0
2: 0
3: 17
4: 188
1024566097_1024566103 12 Left 1024566097 7:50682111-50682133 CCAAGATATTGGGAAGGGACCTG 0: 1
1: 0
2: 0
3: 14
4: 172
Right 1024566103 7:50682146-50682168 GAATCCAGAGACTCTTGAGAAGG 0: 1
1: 0
2: 0
3: 17
4: 188
1024566094_1024566103 21 Left 1024566094 7:50682102-50682124 CCTTGGGAACCAAGATATTGGGA 0: 1
1: 0
2: 1
3: 12
4: 129
Right 1024566103 7:50682146-50682168 GAATCCAGAGACTCTTGAGAAGG 0: 1
1: 0
2: 0
3: 17
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024566103 Original CRISPR GAATCCAGAGACTCTTGAGA AGG Intronic
900695687 1:4008516-4008538 GACTCCAGAGAGTCTGGAAAAGG + Intergenic
902655726 1:17866635-17866657 GAATCCAGTCACTCTGGAGCAGG - Intergenic
902901315 1:19518276-19518298 GGAGCCAGAGACTCTGGAGGAGG + Intergenic
904055871 1:27669473-27669495 GATTCCCGAGGCTCCTGAGAGGG - Intronic
907099905 1:51821543-51821565 GTATCCAGTGTTTCTTGAGAGGG + Exonic
907857353 1:58316870-58316892 GAATAGAAAAACTCTTGAGAAGG - Intronic
912896307 1:113594243-113594265 GAATCAAGAGACTTTAAAGAAGG - Intronic
912985782 1:114428977-114428999 TAATTCAGAAACTCTTGAAATGG + Intronic
913135802 1:115887806-115887828 GAAGCCAGAGTCTCTGGAAAGGG - Intergenic
915049827 1:153056879-153056901 GAAACCAGAAAGTCTTGAAAAGG - Intronic
915054413 1:153112877-153112899 GAAGCCAGGGACTCTTGAAAAGG - Intronic
915056844 1:153140848-153140870 GAAACCAGAGAGTCATGAAAAGG - Intergenic
915995458 1:160558067-160558089 GAGTCCAGAGAGTCTGGACAAGG + Intronic
916996121 1:170302808-170302830 CAATCCAGTGACTGGTGAGAAGG + Intergenic
919857604 1:201716451-201716473 GAAGCCAGAGACTGTAGTGATGG - Intronic
921038789 1:211408960-211408982 GAATCCAGCAACATTTGAGAAGG + Intergenic
921380268 1:214517424-214517446 GAATCTAAAGAAGCTTGAGATGG + Intronic
921649504 1:217659845-217659867 GAATCAAGAGGCTTTTAAGAGGG - Intronic
921893110 1:220372322-220372344 GGATCCAGAAACTTCTGAGAGGG + Intergenic
923358274 1:233182269-233182291 GGATCAGGAGACTGTTGAGACGG - Intronic
924455620 1:244216831-244216853 GAATCCAAAGACTTTTTAAAGGG + Intergenic
1063935942 10:11078501-11078523 GAAACCAGTGACTCTAGAAATGG - Intronic
1065589322 10:27249944-27249966 GCATCCACAGACTGCTGAGAAGG - Intergenic
1067163310 10:43845240-43845262 AAATCCAGAGAATCATGAGGGGG + Intergenic
1068291721 10:55010845-55010867 GAGTCCAGAGACTAGAGAGATGG - Intronic
1068449245 10:57164980-57165002 GACTTCAGAGACTGTTGAGAAGG - Intergenic
1068701126 10:60021101-60021123 GAATCAAGATACTCTAGAGAGGG - Intergenic
1069157324 10:65047222-65047244 GTATCCAGAGACACCTGAGTTGG - Intergenic
1072436000 10:95415236-95415258 GAATCCAGAGACTAATAACATGG - Intronic
1073875534 10:107917663-107917685 GAGTGCTCAGACTCTTGAGAAGG + Intergenic
1074040804 10:109786379-109786401 GGATACAGAGACTCTTGCCAAGG - Intergenic
1074391503 10:113061838-113061860 AAATCCTGACACTCTCGAGAGGG - Intronic
1075052587 10:119193874-119193896 GAATTTAGAGAATCTAGAGATGG + Intergenic
1075632516 10:124009781-124009803 GAACCCAGAGGCTCTCCAGAAGG + Exonic
1076880491 10:133237205-133237227 GAATGCAGAGGCTCCTGCGATGG + Intergenic
1077661122 11:4069431-4069453 AAATCCAGAGACTCTAGAACAGG - Intronic
1077874257 11:6290403-6290425 GAATTCAGAGGGTCCTGAGAAGG - Intergenic
1077928476 11:6706347-6706369 GACTCCAGAGACTCAGAAGAAGG + Intergenic
1078414040 11:11150564-11150586 TAATCCAGAAAGGCTTGAGATGG - Intergenic
1080132401 11:28812296-28812318 GCATCCAAAGGATCTTGAGAGGG - Intergenic
1080924382 11:36740604-36740626 GAATGGAGATACTCCTGAGATGG - Intergenic
1081090017 11:38852882-38852904 GCATTCAGAGACTATTAAGATGG + Intergenic
1086449463 11:86901619-86901641 TAATTCAAAGTCTCTTGAGAGGG + Intronic
1088280749 11:108132340-108132362 CAAAACAGAGACTCTTCAGAAGG - Intronic
1088831866 11:113543808-113543830 GAATCCAGACACTGCTGTGAAGG - Intergenic
1088990185 11:114947028-114947050 GAGTCCAGAAACTCTGGAGAAGG - Intergenic
1089337914 11:117737828-117737850 GAAGCCAGAGAAGCATGAGATGG + Intronic
1091503804 12:1045845-1045867 GGATCCAAAGGCTCCTGAGAAGG + Intronic
1091921115 12:4305723-4305745 GACTCCCTAGACTCTGGAGATGG - Intergenic
1096837600 12:54360949-54360971 GAATCCAGAGACCCCTGACCAGG - Intergenic
1101975057 12:109350255-109350277 GAATCCATAAACTCCTGATATGG + Intronic
1102425965 12:112844662-112844684 GAATCCAGACACTGTGGGGAGGG + Intronic
1102616841 12:114162131-114162153 GACTCAAAGGACTCTTGAGATGG - Intergenic
1104743547 12:131195904-131195926 GAGCCCAGAGACTCATGGGAAGG - Intergenic
1104790787 12:131480780-131480802 GAGCCCAGAGACTCGTGGGAAGG + Intergenic
1106004885 13:25759540-25759562 GAAGCCAGACGCTCCTGAGAGGG + Intronic
1109038154 13:57293487-57293509 GAATCCTGAGACTGTTTAGATGG + Intergenic
1109347312 13:61129827-61129849 GAATCCAGAGAATATAGAGCAGG - Intergenic
1109456866 13:62604198-62604220 TAATCCAGAAACTACTGAGAAGG - Intergenic
1110017303 13:70423595-70423617 AAATCCAAAGACCCTTGAAATGG + Intergenic
1110047670 13:70850922-70850944 GCATCCAGAGAGCCTTCAGAGGG - Intergenic
1111595902 13:90410215-90410237 GAATTTAGAGACTCTGTAGAGGG - Intergenic
1111948394 13:94689819-94689841 GAACCCAAAGAGACTTGAGAAGG + Intergenic
1114549599 14:23525314-23525336 GAATCCAGAGACCCATCAGGAGG + Exonic
1117525603 14:56599392-56599414 GACTACAGAGACTGTGGAGATGG - Intronic
1118439477 14:65799670-65799692 GTATCCAGTGACTCTGGAGATGG - Intergenic
1118763470 14:68894739-68894761 GCATCCTGAGACCCTGGAGAAGG + Intronic
1121674510 14:95741489-95741511 GATTCCAGAGCCTCTTTGGAGGG - Intergenic
1122893246 14:104742642-104742664 CCATCCAGAGAGGCTTGAGAGGG + Intronic
1124159301 15:27254292-27254314 GAGGCCAGGGACTCTCGAGAAGG + Intronic
1125316072 15:38432836-38432858 TGATCCAGAGACTCTTCACAAGG - Intergenic
1125801376 15:42451124-42451146 AAATCCAGAGTCTTCTGAGAAGG + Exonic
1126064983 15:44819695-44819717 GGATCCAGCGGCTCTTCAGAGGG + Intergenic
1126376240 15:47999601-47999623 GAAGCCAGAGACTCTAGAACAGG + Intergenic
1127605605 15:60584242-60584264 TACTCCAGAGAGTCTTAAGAAGG - Intronic
1128925485 15:71651423-71651445 AAATCCGAAGACTCTTGAGTGGG - Intronic
1129837405 15:78719673-78719695 GAATCAAGAAACTCTGGAGTAGG - Intronic
1134374986 16:13663786-13663808 GGTTCCAGAGAGTCTTCAGAAGG - Intergenic
1135005533 16:18818786-18818808 CAATCCACAGCCTCTTGACAGGG + Intronic
1136285643 16:29239062-29239084 CAACCCAGAGACTGATGAGACGG - Intergenic
1137595008 16:49717596-49717618 GAATCCAGGGACTCCAGTGAAGG - Intronic
1138258597 16:55595165-55595187 GAATCCAGATACTCCTGTGTTGG - Intergenic
1140161804 16:72503908-72503930 GAATCAAGAGACTAATAAGAAGG - Intergenic
1142328497 16:89434207-89434229 GAATCCATAGTGTCTTGAGGAGG - Intronic
1142490675 17:276851-276873 GAATCCACAGAATTTTGAGTGGG + Intronic
1143354686 17:6317561-6317583 TAACCCATGGACTCTTGAGATGG - Intergenic
1144806318 17:17970589-17970611 GAATCCAGAGACTCTCCAGTGGG + Intronic
1146593397 17:34148545-34148567 GAATCTAGAGACTTTACAGACGG + Intronic
1148063928 17:44854967-44854989 GATTGCTGAGCCTCTTGAGAAGG - Exonic
1149996458 17:61408436-61408458 GCATCCAGAGACTGGTGAGTGGG + Exonic
1153680067 18:7492027-7492049 GAATCCAGAGAATCACGGGAGGG + Intergenic
1155573884 18:27224224-27224246 GAATCCACAGACACTTTAAAGGG - Intergenic
1157434063 18:47653735-47653757 CAATCCAAAGATTCTTGAGAGGG + Intergenic
1157612102 18:48963568-48963590 GAATCCAGGGACTCGGAAGAGGG - Intergenic
1157615737 18:48986795-48986817 AAATGAAGACACTCTTGAGAGGG - Intergenic
1159924958 18:74260882-74260904 ACATCCAGAGATACTTGAGATGG + Intronic
1160265354 18:77337024-77337046 GCCTCCAGAGAATCTTCAGAAGG - Intergenic
1160668728 19:345667-345689 GAGTGCAGAGAGACTTGAGAAGG + Intergenic
1161613911 19:5259328-5259350 GATTTCAGATATTCTTGAGAAGG - Intronic
1163129746 19:15265078-15265100 CAATTCAGAGACTATTTAGATGG + Intronic
1164123506 19:22288950-22288972 TAATTCAGAGTCTCCTGAGAAGG + Intronic
1166760442 19:45220983-45221005 GACACCAGAGACCCTGGAGATGG + Intronic
1167366645 19:49058069-49058091 CAACCCAGAGACTCATGTGAAGG + Intronic
1168525313 19:57084018-57084040 GAATACAGAGATTCCGGAGAAGG + Intergenic
929596256 2:43178229-43178251 GACTCCAGAGAATAGTGAGAAGG - Intergenic
930278276 2:49339267-49339289 GAAAACAGACACTCATGAGACGG + Intergenic
931172798 2:59822555-59822577 GAATCCATAGACTCCTCAGAAGG + Intergenic
932628051 2:73314578-73314600 GAATCAAGAGACTCATGGGCTGG + Intergenic
933279879 2:80321908-80321930 AAATACAGAGAATCTTCAGAAGG - Intronic
935182933 2:100706329-100706351 GAAACCAGACACTCTGGAGCCGG + Intergenic
937012735 2:118576315-118576337 AAATCCAGAGACTCATGCAAAGG - Intergenic
937687500 2:124714158-124714180 CACTCAAGCGACTCTTGAGAAGG - Intronic
939316255 2:140553686-140553708 GAATCAAGGGACTCTTAACAAGG + Intronic
943514425 2:188866554-188866576 GTATCCTGAGACTCTTCTGAAGG - Intergenic
943722262 2:191217514-191217536 AAATCCAGATACTCTTTTGAAGG + Intergenic
946286319 2:218706174-218706196 GAATCCAGAGAATGTTTGGAAGG + Intergenic
946419161 2:219555271-219555293 GTTCCCAGAGACACTTGAGACGG + Intronic
947243173 2:228018278-228018300 GAATGCAGAGCCTCTTCCGAAGG - Exonic
1170444630 20:16413242-16413264 AATTCCAGAGAGTCTTCAGAGGG + Intronic
1177878132 21:26659837-26659859 GAATACAAAGCCTCTTGATATGG - Intergenic
1178039553 21:28624639-28624661 GGATCTAGAGACTCTAGAGAAGG + Intergenic
1178413736 21:32387121-32387143 GAATCCTCAGGCTGTTGAGAGGG - Intronic
1179104087 21:38383243-38383265 AGATCCAAAGACTCTTGGGAGGG - Exonic
1179523676 21:41961719-41961741 GAAGCCAGAGACTCTCAGGAAGG + Intergenic
1180115928 21:45705010-45705032 GATTCCAGAGTCTGTTGTGAGGG + Intronic
1181572532 22:23775349-23775371 GAATCCTGAGAGTCCTGGGAAGG + Intronic
1185234191 22:49702240-49702262 GGATCCAGAGACTGCTGAGAAGG + Intergenic
951501669 3:23394721-23394743 GAATCCAGAGATTGCTAAGAAGG + Intronic
952926944 3:38327111-38327133 GGATCCAGAGATACTTGAGCTGG + Intergenic
953320360 3:41965891-41965913 GGATGCTGAGACTCTTGAGAAGG - Intergenic
953372581 3:42402112-42402134 TTATCAAGACACTCTTGAGAAGG + Intronic
955728654 3:61960045-61960067 GAATACAGCGACTCCTGAGAAGG - Intronic
957311256 3:78521987-78522009 AACTCCAGAGACTCATGAAATGG - Intergenic
958094353 3:88923143-88923165 CAATCCAGAGTCTCTTGTAAGGG + Intergenic
959409997 3:106009350-106009372 GAATTCATTGACTGTTGAGATGG + Intergenic
960501075 3:118439129-118439151 GAATCCAGAGCCTCTAGGCATGG + Intergenic
961909753 3:130302391-130302413 GACTGAAGAGACTCTGGAGAGGG - Intergenic
962094695 3:132281212-132281234 GACTCCTCAGACTCTTTAGATGG - Intronic
962973927 3:140429672-140429694 GAATGCAGAGACTCAGGGGAGGG + Intronic
963427996 3:145156783-145156805 GGATCCAGAAACACTTGAGTTGG + Intergenic
964099235 3:152968791-152968813 AAAACCAGAGACACTTGTGATGG - Intergenic
965828457 3:172754041-172754063 GATTCCAGAGATACTTGAGGTGG + Intronic
967515867 3:190367894-190367916 GATTGCAGAGACTTTTGGGAAGG - Intronic
967698923 3:192568708-192568730 AAATCCTGAGACTATAGAGATGG + Intronic
968189839 3:196659844-196659866 GATTCCACAGGGTCTTGAGAGGG - Exonic
968807457 4:2784604-2784626 GAATCCACAGACTCCTTTGAAGG - Intergenic
971940036 4:33202108-33202130 GAATCAGGAGACTCTTCAGCAGG - Intergenic
977372694 4:96160237-96160259 GCACCCAGAGACTCTTGAAATGG - Intergenic
980083966 4:128372534-128372556 GAATCCTCAGACTTTAGAGAAGG - Intergenic
980749973 4:137076266-137076288 GATACCTGAGACTCTTGGGAAGG + Intergenic
983869917 4:172813384-172813406 GAATTCAGAGATTCCTGAAAAGG + Intronic
985326544 4:188776731-188776753 GAATCCACAGACCCTTCTGAAGG - Intergenic
985999648 5:3620410-3620432 GACCCCAGAGAGCCTTGAGAAGG - Intergenic
986019975 5:3792072-3792094 GATTTCAGAGAGACTTGAGAGGG + Intergenic
988019932 5:25609179-25609201 GGATCCAGAGAATACTGAGAGGG - Intergenic
989694561 5:44184138-44184160 GAATCCACAGACCCTTTAAAGGG - Intergenic
990261231 5:54024842-54024864 AAATCCAGAGGCTTTTGAAAAGG + Intronic
991664906 5:68990007-68990029 GATTCTAGAAACACTTGAGAAGG - Intergenic
992507925 5:77406404-77406426 GAATCGAGAGATTTTTGAGATGG + Intronic
992509881 5:77422180-77422202 CTAACCAGAGTCTCTTGAGAAGG + Intronic
993275283 5:85849670-85849692 GAATTCAGAGACTGTTGAAAAGG - Intergenic
997416145 5:133730281-133730303 GAATACAGAGAATCTTGATGAGG - Intergenic
1004515396 6:16318200-16318222 GAAAACAGGGACTCTTGTGAAGG - Intronic
1004887721 6:20067793-20067815 GATTCTAGAAACTCCTGAGAGGG - Intergenic
1005501851 6:26435709-26435731 GAAGACAGAGACTCTAGAGTGGG + Intergenic
1007028845 6:38607825-38607847 GAATCCAGAGAGACTGAAGAGGG - Intronic
1007510501 6:42371029-42371051 GAGCCCAGAAACTCTTTAGATGG + Intronic
1008455813 6:51709440-51709462 GAAGTGAGATACTCTTGAGAGGG - Intronic
1008883752 6:56409918-56409940 GAATTCTCAGACTCCTGAGAGGG - Intergenic
1009670168 6:66738896-66738918 GACTCTAGGGACTGTTGAGATGG + Intergenic
1011143501 6:84187930-84187952 GAATCTAGAAACTCTGGAAATGG + Intronic
1015941609 6:138458114-138458136 GAATCCAGTAACTGTTGAAAGGG - Intronic
1016708575 6:147142952-147142974 CAATCCAGAGACTCTAGATTGGG + Intergenic
1024566103 7:50682146-50682168 GAATCCAGAGACTCTTGAGAAGG + Intronic
1025996463 7:66530450-66530472 GAAGCCAGGGAGTGTTGAGAAGG + Intergenic
1026988482 7:74569682-74569704 GAAGCCAGGGAGTGTTGAGAAGG + Intronic
1028571897 7:92298557-92298579 GGATCCAGAGACTCTTTCAAAGG + Intronic
1029358913 7:100073809-100073831 TAATCCAGAGACTTTTCCGAAGG - Intronic
1031963000 7:128006528-128006550 GAATCCCAGGACTCTTAAGAGGG + Intronic
1033268425 7:139908710-139908732 GATTTAAGAGACTCCTGAGAAGG + Intronic
1034111147 7:148538730-148538752 GAGTCCAGAGACTATAGAAATGG + Intergenic
1036708609 8:11062956-11062978 GACTCCAGAGCCCCTGGAGATGG + Intronic
1037167043 8:15843154-15843176 GTATAGAGAAACTCTTGAGAAGG - Intergenic
1037883886 8:22586197-22586219 GAACCCAGAGGCTCTGGAGGAGG + Intronic
1038809826 8:30829056-30829078 GATTCCAGAGGCATTTGAGAAGG - Intergenic
1039983346 8:42427698-42427720 CACTCCAGATACTCTTGTGAGGG + Intronic
1040301709 8:46191413-46191435 AAATCCTGGGACTTTTGAGATGG - Intergenic
1040810226 8:51444335-51444357 AGATCCAGAGACCCTTGAGGGGG - Intronic
1050547211 9:6719062-6719084 GGATCCAGAGATGCCTGAGATGG - Intergenic
1052270029 9:26618079-26618101 AAATCCAAAGATTCTTGAGAAGG - Intergenic
1056094668 9:83240704-83240726 GAATCCAGAAACACGTGGGAAGG - Intergenic
1056775722 9:89511158-89511180 GAATCCAGATAGTCTTGTGCAGG - Intergenic
1058539884 9:106000473-106000495 AAATCCAAACACTCATGAGAGGG - Intergenic
1058967047 9:110048469-110048491 GAATGCAGAGACTGGAGAGAGGG - Intronic
1060455905 9:123796459-123796481 GAAAACATAGACTGTTGAGATGG - Intronic
1062163488 9:135093135-135093157 GAAATCAGAGACTCTGGAGGTGG - Intronic
1189364271 X:40376351-40376373 GCCTCCAGAGACCCTTGGGAAGG + Intergenic
1191225910 X:58043089-58043111 GACTTTAGAGACTATTGAGAAGG - Intergenic
1191948226 X:66559353-66559375 GAAACAACAGACTCTGGAGAGGG + Intergenic
1193046593 X:77060756-77060778 TATTCCAGAGAATGTTGAGATGG + Intergenic
1193222979 X:78948624-78948646 GAATCTAGAGACTCAGAAGAGGG - Intronic
1193569188 X:83121260-83121282 GAATCCAGAGATGCCTGAGTTGG - Intergenic
1193978173 X:88149433-88149455 GAATCTTGAGGCTATTGAGATGG - Intergenic
1195047267 X:101065402-101065424 GAATCAGGAAACTCTGGAGATGG - Intergenic
1195556770 X:106235771-106235793 GAAATCAGAAACTCTTGATAAGG - Intergenic
1197575570 X:128207305-128207327 GAATCCACAGACACTTGAATAGG + Intergenic