ID: 1024573046

View in Genome Browser
Species Human (GRCh38)
Location 7:50740396-50740418
Sequence ATTAGTCAGCAGATCTTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024573046_1024573049 8 Left 1024573046 7:50740396-50740418 CCAAGAAAGATCTGCTGACTAAT 0: 1
1: 0
2: 0
3: 14
4: 159
Right 1024573049 7:50740427-50740449 GTTGTACAATTAATGATGATTGG 0: 1
1: 0
2: 1
3: 12
4: 138
1024573046_1024573050 9 Left 1024573046 7:50740396-50740418 CCAAGAAAGATCTGCTGACTAAT 0: 1
1: 0
2: 0
3: 14
4: 159
Right 1024573050 7:50740428-50740450 TTGTACAATTAATGATGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024573046 Original CRISPR ATTAGTCAGCAGATCTTTCT TGG (reversed) Intronic
902623970 1:17666311-17666333 ATTGATCAGCAGCTCTTCCTGGG + Intronic
908154418 1:61337884-61337906 ATTTTTCAGGAGAACTTTCTGGG - Intronic
909007715 1:70297080-70297102 ATTAGTTAGGGTATCTTTCTTGG - Intronic
909454833 1:75838483-75838505 ATTAGGAAGCAGATCTCTTTGGG + Intronic
910450499 1:87338761-87338783 ATTTGTCATCATATCTCTCTGGG - Intronic
914884777 1:151575963-151575985 ATTAGTCAGCACTCCTTCCTCGG + Intronic
915523958 1:156464887-156464909 ATTAGTCTGCCCACCTTTCTAGG - Exonic
917952835 1:180058095-180058117 ATGACTCAGCAGTTCTGTCTTGG + Intronic
921305429 1:213791920-213791942 ATTAGACAGCAGAGCCATCTTGG - Intergenic
922380896 1:225024308-225024330 AATATTCAACAGATATTTCTTGG - Intronic
1064719737 10:18217087-18217109 ATTGGTGAGCAAATATTTCTTGG + Intronic
1065416240 10:25489930-25489952 ACTAGTCAGTAAATCTTTCAAGG - Intronic
1066233530 10:33462512-33462534 ATAATTTAACAGATCTTTCTGGG - Intergenic
1066308262 10:34168941-34168963 ACAAGGCAGCAGATATTTCTAGG - Intronic
1068006348 10:51395889-51395911 AATAGACAGGAAATCTTTCTAGG - Intronic
1069419494 10:68234225-68234247 CTTTGTCAATAGATCTTTCTAGG - Intergenic
1072486398 10:95860358-95860380 TTTACTCAGCAGAACTTTCCAGG + Intronic
1073448806 10:103597270-103597292 AGAAGTCACCAGATCTTTTTGGG - Exonic
1074381736 10:112986241-112986263 GTGAGTCAGTAGATGTTTCTCGG + Intronic
1074892084 10:117744152-117744174 ATTTGTAAGCAGATCTGCCTGGG + Intergenic
1079226797 11:18613893-18613915 CTTATTCAGCAGATATTTCTTGG - Intronic
1082784715 11:57310518-57310540 TTCACTCTGCAGATCTTTCTGGG + Exonic
1082915060 11:58424602-58424624 TTTAGTCTGCAGATCTGTTTTGG + Intergenic
1085548469 11:77343875-77343897 ATTAATAATCAGCTCTTTCTTGG + Exonic
1085983544 11:81755487-81755509 TTTATTCAGCAAATATTTCTTGG + Intergenic
1086849184 11:91788945-91788967 ATGAGTCAGCAGGTCCTTCTGGG - Intergenic
1088603628 11:111507876-111507898 ATCAGCCAGCAGACCTTTCTTGG + Intronic
1090618363 11:128538215-128538237 ATAAGTCAGTAGACTTTTCTAGG - Intronic
1093946899 12:25119788-25119810 ACCAGACAGCAGATTTTTCTGGG + Intronic
1094386625 12:29901372-29901394 ATTATTCAGCAAATATTTATTGG - Intergenic
1098382055 12:69879773-69879795 CTTAATTAGCAGATATTTCTCGG - Intronic
1099469318 12:83027198-83027220 ATTTCTCAGCAGATTTTTCCTGG - Intronic
1100848414 12:98683999-98684021 AAAAGTTAGCAGATCTTTCTGGG - Intronic
1102328221 12:112007761-112007783 ATTAGTCTGCTGCTCTTGCTAGG + Intronic
1102902334 12:116648031-116648053 GTTAGTCAGAAGATTTTTCCAGG - Intergenic
1105669714 13:22599365-22599387 GTTTGGCAGCAGAACTTTCTAGG + Intergenic
1106804628 13:33293491-33293513 ATTGGACAGCAGATAATTCTAGG + Intronic
1107723968 13:43278885-43278907 TTTAGTCTGCATTTCTTTCTTGG + Intronic
1108341251 13:49500248-49500270 AATAGTCAGCAGGGCTTTCCAGG - Intronic
1108733253 13:53256803-53256825 ATAAGCCAGCAGCTCTTTTTAGG - Intergenic
1110155508 13:72311972-72311994 ATTACCTAGCAGAACTTTCTTGG + Intergenic
1111159125 13:84370248-84370270 ATTTTTCAGCACATCTGTCTTGG - Intergenic
1111574911 13:90141171-90141193 TTTAGACAGCAGTTCTTTGTGGG - Intergenic
1112200588 13:97270140-97270162 ATTAGTCAACAGAACTTCCAGGG - Intronic
1112302631 13:98244042-98244064 ATCAGTGAGCAGATTTCTCTGGG + Intronic
1115070383 14:29315533-29315555 GTTAATCATCACATCTTTCTTGG - Intergenic
1116363295 14:44028685-44028707 AATAGAAAGCAGATCTTTATTGG - Intergenic
1118302136 14:64625423-64625445 ATTCTTCGGCAGCTCTTTCTGGG - Intergenic
1121222864 14:92299503-92299525 AATAGTCCCCAGATCTTCCTGGG - Intergenic
1121886309 14:97546272-97546294 ATAAGTCAGAAGATCATTCCCGG + Intergenic
1124681333 15:31733668-31733690 TTTATTCAGCAGATATTTGTCGG - Intronic
1129238725 15:74239436-74239458 ATTAGCCAGCAGATGTTGCAGGG - Intronic
1129344872 15:74910868-74910890 ATGAATCTGCAGGTCTTTCTGGG + Intergenic
1130808842 15:87355350-87355372 ATTAGGCTGCAGGTCTTTTTAGG + Intergenic
1132433091 15:101776118-101776140 ATAAGTCACTGGATCTTTCTGGG - Intergenic
1134377505 16:13691183-13691205 ATTTGTCTGCAAATCTGTCTAGG - Intergenic
1135049336 16:19179782-19179804 ATTTCTCAGCAGTTCTTTATTGG + Intronic
1137339840 16:47590765-47590787 CACAGTCAGGAGATCTTTCTTGG + Intronic
1137458554 16:48637196-48637218 CCTGGTCAGCAGATCTTTCTGGG + Intergenic
1137570024 16:49559182-49559204 ATAAGTCAGTAGACCTCTCTGGG - Intronic
1137613125 16:49832346-49832368 TTTCCTCAGCAGATCTCTCTGGG - Intronic
1140605514 16:76532142-76532164 TTTATTTAGCAGCTCTTTCTGGG - Intronic
1140850576 16:78931462-78931484 CATAGTCAGCAGATTTTGCTGGG + Intronic
1140852534 16:78948514-78948536 ATCAGGCAGCAGAGCTGTCTTGG - Intronic
1153958360 18:10118232-10118254 ATGATTCTGCAGATATTTCTAGG - Intergenic
1154054671 18:11001318-11001340 AAAAGTCAGCACATCTTGCTAGG + Intronic
1154381582 18:13855969-13855991 ATTAGACCGCAGATATCTCTTGG - Intergenic
1156913328 18:42437141-42437163 ATTAGGCAGCATATCTTGCATGG + Intergenic
1159849649 18:73512750-73512772 ATTAGTCAACAGGTATTTATTGG + Intergenic
1160423072 18:78762227-78762249 ATTACCCAGCAAATCTTTATTGG + Intergenic
1162554805 19:11380216-11380238 ATTTGTCATCAAATATTTCTTGG + Intronic
1163377525 19:16942631-16942653 CTGAGTCAGCAGAGGTTTCTTGG - Intronic
1165561730 19:36686333-36686355 ATGAGACATCAGACCTTTCTTGG + Intergenic
1166193245 19:41189931-41189953 ATTAGACAACACATCCTTCTGGG - Intergenic
926177088 2:10603602-10603624 ATTTGTCAGCTGTTCTTTCTTGG - Intronic
926383430 2:12313685-12313707 AAGAGTCAGATGATCTTTCTGGG + Intergenic
928038919 2:27853933-27853955 ATTAGTCACCAGGTCTTTCCAGG - Intronic
928649569 2:33390210-33390232 ATTAGTGAGCACAGCTTTCATGG + Intronic
928662051 2:33512296-33512318 ATTACTCAGCTGAGCTGTCTGGG - Intronic
930346945 2:50195125-50195147 ATTGGTCAGCAGTTCTTTTCTGG + Intronic
931264572 2:60649256-60649278 TTTATTCAGCAGATTTTTGTGGG - Intergenic
935919136 2:107991149-107991171 ATTAATCTGTAGATCATTCTTGG + Intronic
936766663 2:115858266-115858288 ATTTCTCAGCAGAACTTTATAGG - Intergenic
942149493 2:173061060-173061082 TTTAGTTTGCAGATCATTCTTGG + Intergenic
942415654 2:175756614-175756636 ATTAGTTAGCATATTTATCTAGG + Intergenic
942515895 2:176752905-176752927 AGTGGTCAACAGATCTTTGTTGG - Intergenic
943178576 2:184511160-184511182 ATTATTCAGTAGTTCTTTATAGG - Intergenic
944816603 2:203383664-203383686 ATTCTTCATTAGATCTTTCTAGG - Intronic
946076015 2:217074238-217074260 ATTATTCCTCAGATCATTCTTGG + Intergenic
946228139 2:218275679-218275701 TTTGGTCAGCAGATTTGTCTTGG + Intronic
947158147 2:227184526-227184548 AATATTGACCAGATCTTTCTTGG - Intronic
1174667757 20:52275962-52275984 AGTAACCAGCAGATTTTTCTGGG + Intergenic
1177115128 21:17075848-17075870 TTGAGTCAGCAAATCTATCTAGG + Intergenic
1177474255 21:21597984-21598006 CTTAGTCATCAGATTTTTCAAGG - Intergenic
1177953712 21:27570399-27570421 ATTAGTCAGTCGAGCTTCCTGGG + Intergenic
1181053622 22:20249097-20249119 ATTAGGCAGCAGGTGTTTGTTGG - Intronic
1181289446 22:21780150-21780172 ATTATTCAGCAGATGGTACTGGG - Intronic
1182657470 22:31902182-31902204 ATGAGTCAGTAGATATTTCTTGG + Intronic
1183916181 22:41121459-41121481 ATTCCTCAGCAGATCTGTGTGGG + Intronic
949178137 3:1091942-1091964 ATAAGTCAAAAGATATTTCTTGG - Intergenic
949268715 3:2189392-2189414 AGAACTCAGCAGATCTCTCTGGG + Intronic
951093562 3:18602042-18602064 CTTACTCAGCACATCTTCCTAGG + Intergenic
951363532 3:21752164-21752186 ATTAATCAGCACAGCTTTCAGGG - Intronic
951607006 3:24446705-24446727 AATATTCAGCAAATCTTTGTGGG + Intronic
953084383 3:39652752-39652774 ATTAGACAGCAGAAATGTCTTGG - Intergenic
955180855 3:56668045-56668067 ATTAGGCAAGAGATCTTTCTAGG + Intronic
957040877 3:75334574-75334596 CTAAATCAGCAGAACTTTCTAGG + Intergenic
957231604 3:77524520-77524542 TTTAGTCAGCAAATATTTTTCGG - Intronic
959047977 3:101495974-101495996 ATTGGTCAGTAGATATTTATTGG - Intronic
959525362 3:107370812-107370834 ATCATTTAGCAGATCTTTTTTGG - Intergenic
959887839 3:111522892-111522914 ATTAATGAGAAGATCTTGCTAGG - Intronic
960369834 3:116821350-116821372 ATTGGTCAGAACATGTTTCTTGG + Intronic
965135283 3:164758091-164758113 ATTAATCAGCATGTCTTTCTTGG - Intergenic
965664803 3:171081866-171081888 TTTAGTAAGCAGAAATTTCTTGG - Intronic
967742129 3:193015094-193015116 ATTAGCCAGCTGTTTTTTCTTGG + Intergenic
971456405 4:26849245-26849267 ATTAGATAATAGATCTTTCTTGG - Intergenic
973854949 4:55002051-55002073 ATTAGCCACCAGACCCTTCTTGG - Intergenic
974365131 4:60937187-60937209 CTTAGTCATCAGATCTATTTGGG - Intergenic
978970872 4:114804470-114804492 ATTTCTCAGCAGAAATTTCTTGG + Intergenic
979913842 4:126405190-126405212 ATTTGCCTGCAGATCTCTCTGGG - Intergenic
980975645 4:139607635-139607657 ATCACTCAGTAGATCATTCTTGG - Intergenic
982245598 4:153347286-153347308 TTTAGTGAGCAGATCTGTATGGG + Intronic
983128540 4:163985022-163985044 ATTAGTAATCAGATTTTCCTTGG - Intronic
986618493 5:9644956-9644978 ATTGGTCTGCAGATTTTTATTGG + Intronic
988725742 5:33924622-33924644 ATGAGTAAGCAGATCTTACGTGG + Intergenic
988867800 5:35354505-35354527 ATAAGTCAAAAGATGTTTCTGGG - Intergenic
993260772 5:85655506-85655528 ATCTGTCAGTAGATCATTCTGGG - Intergenic
994516426 5:100777988-100778010 ATTTGGCAGCATATCTCTCTTGG + Intergenic
994761632 5:103861650-103861672 CTTAATCATCAGATCTTCCTGGG - Intergenic
995071645 5:107929660-107929682 ATACATCAGCAGATATTTCTTGG - Intronic
995988155 5:118205751-118205773 ATGATTCAGCAGCTCTTTCCAGG + Intergenic
997828925 5:137132333-137132355 ATTAGGGATCAGATCTTGCTGGG - Intronic
998939697 5:147267941-147267963 ACTAGTCTGCAGATGTTTATAGG - Intronic
1000453014 5:161413947-161413969 ATTAGCCAACATATTTTTCTTGG - Intronic
1005678994 6:28186106-28186128 ATTAATGAGCAGGTCTATCTTGG + Intergenic
1009833353 6:68967497-68967519 ATTAGTCAAAAGATGTTTCCAGG - Intronic
1010108729 6:72199130-72199152 ATTAGTCATTGGATATTTCTTGG - Intronic
1011790851 6:90896633-90896655 ATTGGTATGCAGATGTTTCTTGG + Intergenic
1012009827 6:93769512-93769534 GTCAGACAGCAAATCTTTCTTGG - Intergenic
1013845439 6:114445105-114445127 ATTACTCAGCAGATCTTCAGAGG + Intergenic
1014617713 6:123624471-123624493 ATAAGTCAGCAGAATTCTCTAGG - Intronic
1017318149 6:153056604-153056626 ATTAGACAGAAAATCTCTCTTGG + Intronic
1017780382 6:157711040-157711062 ATTATTAGGCAGATTTTTCTGGG + Intronic
1018580163 6:165301620-165301642 ATTCTTCAGGAGATCTTGCTTGG + Exonic
1018673070 6:166195442-166195464 ATTTGTCAGCAGCTGTTCCTAGG - Intergenic
1019092301 6:169549153-169549175 ATTAGATAGCAGTTCTTTATCGG - Intronic
1023113532 7:36838214-36838236 ATCACTCAGCAGACTTTTCTGGG + Intergenic
1024573046 7:50740396-50740418 ATTAGTCAGCAGATCTTTCTTGG - Intronic
1024873036 7:53988126-53988148 ATTGGTCAGAACATCCTTCTTGG - Intergenic
1030574200 7:111265674-111265696 ATTTCTAAGCAGACCTTTCTTGG - Intronic
1031974542 7:128085367-128085389 ATTAGCCAGCAGATCTGCCTGGG - Intronic
1033382275 7:140833500-140833522 ATTACTAAGCATATCTTTCCAGG - Intronic
1035416329 7:158691076-158691098 ATTGGTCAGTAGACCTGTCTTGG - Intronic
1036290141 8:7480562-7480584 TTCAGTCAGCATAACTTTCTGGG - Intergenic
1036331335 8:7830958-7830980 TTCAGTCAGCATAACTTTCTGGG + Intergenic
1037322920 8:17660547-17660569 ATGAGTCAGCAATTCCTTCTGGG - Intronic
1037996486 8:23356234-23356256 ATTAGTCAGCAGTTCACCCTGGG + Intronic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1039827965 8:41190920-41190942 ATGAGTCCCCACATCTTTCTTGG - Intergenic
1040000486 8:42571691-42571713 TTTTATCAGCAAATCTTTCTGGG + Intergenic
1046060267 8:109130949-109130971 ATTAGTAAGCATTTCTGTCTTGG + Intergenic
1046617430 8:116492804-116492826 ATTAGGAACCAGATTTTTCTCGG + Intergenic
1047593430 8:126351519-126351541 ATTACTCAGGAGGTTTTTCTGGG + Intergenic
1050900031 9:10935976-10935998 CTTAATCAGCAGATGATTCTAGG + Intergenic
1054959512 9:70952107-70952129 AAGAGTGAGCAGATCTTTTTAGG - Intronic
1055394561 9:75860284-75860306 ATTTCTTATCAGATCTTTCTTGG + Intergenic
1056924598 9:90822293-90822315 TTAAGTCAGCAGATTTTTCTTGG + Intronic
1057785334 9:98083178-98083200 CTTAGACAGCAGATGTTTCTGGG + Intronic
1059138615 9:111831190-111831212 ATAAGTCTGTAGATCTCTCTGGG + Intergenic
1060033389 9:120234585-120234607 ATTGGTCAGTACATCTCTCTGGG + Intergenic
1188315388 X:28667214-28667236 ATTAGTCACCATAACTATCTTGG - Intronic
1195077134 X:101337957-101337979 ATTAGTCAGCAAATCCCTCATGG - Intergenic
1196347280 X:114678526-114678548 ATTAGTAGGCAGACCATTCTGGG + Intronic
1198768481 X:140103071-140103093 GCAAGTCAGCAGATCTTTCTGGG - Intergenic