ID: 1024573171

View in Genome Browser
Species Human (GRCh38)
Location 7:50742424-50742446
Sequence TAGGATCCTGGTTAAGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 302}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024573171_1024573178 10 Left 1024573171 7:50742424-50742446 CCATGCTCTTAACCAGGATCCTA 0: 1
1: 0
2: 4
3: 39
4: 302
Right 1024573178 7:50742457-50742479 GGTTTTCAAATGATGGTCCCCGG 0: 1
1: 0
2: 10
3: 62
4: 386
1024573171_1024573180 24 Left 1024573171 7:50742424-50742446 CCATGCTCTTAACCAGGATCCTA 0: 1
1: 0
2: 4
3: 39
4: 302
Right 1024573180 7:50742471-50742493 GGTCCCCGGACATACAGCATGGG 0: 1
1: 0
2: 0
3: 6
4: 85
1024573171_1024573176 3 Left 1024573171 7:50742424-50742446 CCATGCTCTTAACCAGGATCCTA 0: 1
1: 0
2: 4
3: 39
4: 302
Right 1024573176 7:50742450-50742472 GTCCTAGGGTTTTCAAATGATGG 0: 1
1: 0
2: 0
3: 11
4: 96
1024573171_1024573179 23 Left 1024573171 7:50742424-50742446 CCATGCTCTTAACCAGGATCCTA 0: 1
1: 0
2: 4
3: 39
4: 302
Right 1024573179 7:50742470-50742492 TGGTCCCCGGACATACAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024573171 Original CRISPR TAGGATCCTGGTTAAGAGCA TGG (reversed) Intronic
901136857 1:7002965-7002987 AAGGAACATGGTAAAGAGCATGG + Intronic
901270271 1:7947484-7947506 TAAGAGTCTGGTTAAGAGCATGG - Intergenic
903110205 1:21126315-21126337 TAGTATTGTGGTTAAGAGTATGG - Intronic
903739480 1:25550363-25550385 TAGCCTCGTGGTTAACAGCAAGG - Intronic
904320452 1:29694781-29694803 TGACATCCTGGTTAAGAGCTAGG + Intergenic
904349633 1:29896553-29896575 CAGGATCACAGTTAAGAGCATGG - Intergenic
905334680 1:37236343-37236365 GAGGAACTTGGTTCAGAGCAAGG + Intergenic
905549447 1:38824388-38824410 CAGAATCATGGTTAAGAGCTTGG - Intergenic
905821350 1:40994189-40994211 CATGACCTTGGTTAAGAGCAAGG - Intronic
905821753 1:40998087-40998109 GAGTGTCATGGTTAAGAGCATGG + Intronic
906250569 1:44307800-44307822 TAGTATAATAGTTAAGAGCAAGG + Intronic
906738868 1:48161130-48161152 CAGGAGCCTGGTGAAAAGCAGGG + Intergenic
906950952 1:50333970-50333992 CAGGGTCGTGGTTAAGAGCATGG + Intergenic
907557807 1:55359917-55359939 TATTTTCCTGGTTAAGAGCCTGG + Intergenic
907628833 1:56059965-56059987 TGGCATGATGGTTAAGAGCATGG - Intergenic
908381604 1:63602170-63602192 TAATATGCTGGTTAATAGCATGG + Intronic
908942215 1:69448970-69448992 TAGCATCTTGGTTAAGAGCATGG - Intergenic
911391031 1:97243531-97243553 TAGCATTGTGGTTAAGAGCATGG - Intronic
911516386 1:98873100-98873122 TAGGATCCTGGAGCAGAACAAGG - Intergenic
912366090 1:109135103-109135125 CAGCTTCCTGGTTTAGAGCAGGG + Intronic
912465175 1:109867730-109867752 TAGAATAATGGCTAAGAGCATGG - Intergenic
912502908 1:110134041-110134063 TAGTATCATGGTTTAGAGCATGG + Intergenic
912740268 1:112188270-112188292 AAGAATCCTGTTTAAGAGAAAGG - Intergenic
913003808 1:114608353-114608375 TAGGGTAGTGGTTTAGAGCATGG - Intronic
914880771 1:151545001-151545023 TAGCATTGTGGTCAAGAGCATGG + Intronic
915981431 1:160422389-160422411 TTTGCTCCTGGTTAAAAGCAAGG - Intronic
916053180 1:161050062-161050084 TAGGATAGTGGGTAAGAACATGG - Intronic
916086499 1:161273936-161273958 TAGGATAATGATCAAGAGCATGG + Intronic
916895728 1:169159921-169159943 TAGGATCATGGTTAGGAGGTAGG - Intronic
918150705 1:181796048-181796070 TAGGATCTTGGTTAACAATATGG - Intronic
918277092 1:182963661-182963683 TAGCATAGTGGTTAAGAGCAGGG - Intergenic
918370345 1:183854694-183854716 TAGTATAATGGTTAAGAACATGG + Intronic
918380996 1:183955104-183955126 TAGGATAATGGTTAAGAGGAAGG + Intronic
921545050 1:216464688-216464710 TAGTATACTGGTTATGAACATGG + Intergenic
921792974 1:219310772-219310794 TAGGAAACTGGTTAAGAAAATGG + Intergenic
921803859 1:219432423-219432445 TAGGATCCAGGTTCAGACTAGGG + Intergenic
922040182 1:221888802-221888824 TAGGATCCAGGTAAGGAGGATGG + Intergenic
924524843 1:244836551-244836573 TGGGCTCCTTATTAAGAGCAGGG + Intronic
1065361648 10:24894746-24894768 TAGGATAGTGGTTAAGATCGTGG + Intronic
1066123024 10:32309885-32309907 TAGTATAGTGGTTAAGAACATGG + Intronic
1067293379 10:44960138-44960160 TAGGAAACTGGTTAAGGACAAGG - Intronic
1067516082 10:46945958-46945980 AAGGAATCTGGTTAAGAACACGG + Intronic
1067577945 10:47419689-47419711 TGGGACCCTGGTTTGGAGCAGGG - Intergenic
1067646166 10:48105852-48105874 AAGGAATCTGGTTAAGAACACGG - Intergenic
1067981892 10:51096554-51096576 TAGTATACCGGGTAAGAGCATGG + Intronic
1068580494 10:58733826-58733848 TAGGATAGTAGTTAGGAGCATGG + Intronic
1068628567 10:59275653-59275675 TAGGCTACTGGTTAAAAGCCCGG + Intronic
1068657901 10:59593430-59593452 TAGTATCCTGGTGAAGTGCTTGG - Intergenic
1069751275 10:70746813-70746835 TGTGAGCCTGGTTCAGAGCAGGG + Intronic
1069751875 10:70750087-70750109 TAGGAGCCTGGGCAAGGGCAAGG + Intronic
1069900361 10:71703313-71703335 GACCCTCCTGGTTAAGAGCATGG + Intronic
1069997083 10:72349001-72349023 TAGCAGCGTAGTTAAGAGCATGG - Intronic
1072481730 10:95815594-95815616 TAGGGTGCTGGTTAAAAGCCTGG + Intronic
1072534676 10:96353151-96353173 TAGCACAGTGGTTAAGAGCATGG - Intronic
1072904113 10:99434950-99434972 TAGCATAATGGTTAAAAGCATGG + Intergenic
1073219491 10:101858256-101858278 TGGCATAGTGGTTAAGAGCACGG + Intronic
1073538817 10:104301422-104301444 CAGGACCCTGGTAAACAGCAGGG - Intronic
1074191120 10:111138599-111138621 CAGCATCATGGTTAAGAACACGG - Intergenic
1074877522 10:117625741-117625763 TAGCATCCTGCTTAAGGCCATGG - Intergenic
1077954119 11:6995072-6995094 TAGCCTATTGGTTAAGAGCAAGG - Intergenic
1079289206 11:19171930-19171952 TAGGTTGTTGGTTAGGAGCATGG + Intronic
1079652952 11:22953084-22953106 TGGGATCCTGGTCCAGAGAAAGG + Intergenic
1079779532 11:24583415-24583437 TAGCATTTTGGTTAAGAGCAGGG + Intronic
1080743273 11:35084955-35084977 TGGCATCCTGGGAAAGAGCATGG + Intergenic
1081864010 11:46349823-46349845 TGGGATCCTGGTATAGAGAAAGG - Intronic
1081960507 11:47133144-47133166 TAGCATTGTGGTTAATAGCATGG - Intronic
1082890325 11:58132303-58132325 CAGGATAGTGGTTAAGAGTAAGG + Intronic
1083081671 11:60100379-60100401 TAAGACCCTGGGTAAGATCAGGG + Intergenic
1085153422 11:74270788-74270810 TAGCATGATGGTTATGAGCAGGG - Intronic
1086290449 11:85303056-85303078 TAGGATAGTGGTTAAGAGCAGGG - Intronic
1086726965 11:90198221-90198243 CAGAATAGTGGTTAAGAGCATGG + Intergenic
1087112147 11:94482359-94482381 TAGCATAGTGATTAAGAGCATGG - Intronic
1087621228 11:100545026-100545048 TAGCATAATAGTTAAGAGCATGG - Intergenic
1088152646 11:106764362-106764384 TAGGGTAATGGTTACGAGCATGG + Intronic
1089088324 11:115843094-115843116 TAGGATAGTAGTTAAGACCAGGG + Intergenic
1090048151 11:123354429-123354451 TAGCAAGGTGGTTAAGAGCATGG - Intergenic
1090217813 11:124985008-124985030 TAGGATTGAGGTTAAGGGCAAGG - Intronic
1090734275 11:129597759-129597781 TAGCATAGTGATTAAGAGCACGG + Intergenic
1093203402 12:16217436-16217458 TTGCATCAAGGTTAAGAGCATGG + Intronic
1094503382 12:31039562-31039584 TAGGATACTGGGTTAGGGCAAGG + Intergenic
1095297908 12:40548101-40548123 TAGTATCATGGTTAAGAGGATGG - Intronic
1095859088 12:46894869-46894891 TAGAATACTAATTAAGAGCATGG - Intergenic
1096205781 12:49720392-49720414 TAGCATAATGATTAAGAGCATGG + Intronic
1096217770 12:49808035-49808057 AAGCATCCAGGTTAAGAGCAAGG + Intronic
1097604606 12:61737491-61737513 TAACATAGTGGTTAAGAGCATGG + Intronic
1097696458 12:62779726-62779748 CAGGATGGTGGTTAAGAGCAGGG - Intronic
1098321415 12:69247987-69248009 TACGATCCTAATTAAGACCATGG - Intronic
1099018294 12:77372134-77372156 TAGAATCCTGATTAAGTCCATGG - Intergenic
1099983522 12:89635472-89635494 TAGGGTACTAGTTAAGAGTAAGG + Intronic
1100803590 12:98258365-98258387 GATGAGGCTGGTTAAGAGCAGGG + Intergenic
1101129386 12:101673049-101673071 CAGGATAATTGTTAAGAGCATGG - Intronic
1101385102 12:104250072-104250094 TAACATACTGGTTAAAAGCATGG + Intronic
1104485418 12:129147989-129148011 TGGCATCCTGTTTAAGCGCATGG - Intronic
1105291255 13:19055180-19055202 TTGGATCCTGGCTCAGGGCAGGG + Intergenic
1106058136 13:26258237-26258259 AAGCATAATGGTTAAGAGCATGG - Intronic
1106636838 13:31537988-31538010 TTGCATGCTGGTTATGAGCATGG + Intergenic
1110085696 13:71376567-71376589 TAGCATGCTGGTCAAGTGCATGG - Intergenic
1110302030 13:73939908-73939930 TATGATCCTGGTGAGGAGCAAGG - Intronic
1114738696 14:25070670-25070692 TAACATACTGGTTAAGTGCATGG - Intergenic
1115075982 14:29390902-29390924 AAGGATCTTGTTTAAGAGAATGG - Intergenic
1115157863 14:30360872-30360894 TAGCATAGTGGTTAAGACCATGG + Intergenic
1115222353 14:31070547-31070569 TAGGATCTTGGTTTCTAGCAAGG + Intronic
1115499480 14:34036511-34036533 TAGCATAATGGTTAGGAGCAGGG - Intronic
1118637592 14:67762191-67762213 TTGTATCCTTGGTAAGAGCAAGG - Exonic
1119828274 14:77676525-77676547 TAGTATCCTGGATAAGATCCTGG + Intronic
1119863914 14:77957225-77957247 TTGGATCCTTCTTAAGAGAATGG - Intergenic
1119887901 14:78159351-78159373 TAGCATCATGTTTAAGAGAAGGG - Intergenic
1120524974 14:85567411-85567433 CATTATGCTGGTTAAGAGCATGG + Intronic
1120937720 14:89914279-89914301 TAAGGCCCTGGCTAAGAGCATGG + Intronic
1124510053 15:30316290-30316312 TAAGATCATAATTAAGAGCACGG + Intergenic
1124732837 15:32214263-32214285 TAAGATCATAATTAAGAGCACGG - Intergenic
1124876755 15:33601996-33602018 GAGGATCAGGGTGAAGAGCAGGG + Intronic
1125322326 15:38501434-38501456 TTGTATCCTTGTTAAGAGTAGGG - Intronic
1125477508 15:40057226-40057248 TAGAAACCTGGTTTAGAACAAGG - Intergenic
1125992794 15:44126575-44126597 TTGGCTCCTGGTCAAGAGGATGG - Intronic
1126945158 15:53811033-53811055 CAGGATCCAGGTTAAGAGGCTGG - Intergenic
1126978752 15:54217267-54217289 TAGGATTGTGGATAAGGGCAAGG + Intronic
1127109159 15:55649234-55649256 TAGCATAGTGGTTAAGAGCTGGG + Intronic
1127636398 15:60874767-60874789 TAGGATCATGGTTAAAAGTGTGG + Intronic
1128851681 15:70964239-70964261 TAGCATAGTGGTTAAGAGCATGG + Intronic
1129179536 15:73865192-73865214 TGGCCTACTGGTTAAGAGCATGG - Intergenic
1129542204 15:76359602-76359624 TGGGCTCCTGATTGAGAGCAAGG + Intronic
1130073768 15:80671154-80671176 CAGGATACTGGGTAAGAGCTTGG + Intergenic
1130181581 15:81634790-81634812 TAGCAAAATGGTTAAGAGCATGG + Intergenic
1132225725 15:100139857-100139879 TAGGATCCTGGTATACAGAAAGG + Intronic
1133896343 16:9932893-9932915 TGGCATCACGGTTAAGAGCATGG - Intronic
1134023547 16:10938277-10938299 TAGGGTCATGGTTAAGAGCCAGG - Intronic
1134109356 16:11505112-11505134 TAGGATGCTTGTTAAGAGTGTGG - Intronic
1141492083 16:84380615-84380637 CAGGATTGTGGTTAAGAGCACGG + Intronic
1142697465 17:1641309-1641331 TTAGATCCTCGTAAAGAGCATGG - Intronic
1142949734 17:3468608-3468630 TAGCATAATGATTAAGAGCATGG + Intronic
1143830595 17:9647390-9647412 TAGTATAGTGGTTAAGAGCAAGG + Intronic
1143989067 17:10941351-10941373 TAAAATCCTGGTGAAGATCATGG + Intergenic
1144039193 17:11393342-11393364 TAGGATCCTGGCTAAGAAGGGGG - Intronic
1144066223 17:11626712-11626734 TAGGACCCTGGTCAAGTGCAAGG - Intronic
1144588468 17:16503476-16503498 TAGGTTCCTGATTAAAAGCCGGG - Intergenic
1145921589 17:28614000-28614022 GAAGTTCCTGGTTAGGAGCATGG - Intronic
1146481572 17:33209131-33209153 TAGGATGGTAGTTAACAGCATGG - Intronic
1146680829 17:34806817-34806839 TAGCATCATGGCTAAGGGCATGG - Intergenic
1148543029 17:48494960-48494982 TAGAGCCATGGTTAAGAGCATGG + Intergenic
1148588904 17:48800876-48800898 TAGCACCCCGGTTAGGAGCAGGG - Intronic
1153481634 18:5553432-5553454 TAGCATCATGGTTAAGAGCATGG - Intronic
1155422883 18:25674688-25674710 TAGCATTGTGGTTAAGAACACGG - Intergenic
1156521362 18:37724688-37724710 CAGGGTCCTGGTGAGGAGCAGGG - Intergenic
1156940438 18:42760576-42760598 AAGCATCCTGTTTAAGAGGATGG + Intronic
1157279686 18:46338016-46338038 TATGATGCTGGTGAAGAGAAGGG + Intronic
1158159095 18:54459564-54459586 TAGGACACTGGTTAAGTGCAAGG - Intergenic
1158265959 18:55661009-55661031 TAGTGTAATGGTTAAGAGCATGG - Intronic
1161129972 19:2582120-2582142 TGGGATCCTGGATCAGATCATGG + Intronic
1162003525 19:7763333-7763355 TGGGATCCTGGGTAAGGGGAAGG + Intronic
1162173222 19:8807865-8807887 TAGGGTAGTGGTTAAGTGCATGG + Exonic
1162494409 19:11015294-11015316 TGGGATCCTGGACCAGAGCAAGG - Intronic
1164924270 19:32115307-32115329 TAAGATTCTGGTTCAGAGAAAGG - Intergenic
1165300107 19:34963454-34963476 TAGGATCCTGAATCAGGGCAGGG - Intronic
1165697673 19:37913277-37913299 TAGGACCCTGGCTCACAGCAGGG - Intronic
1165697900 19:37914973-37914995 TAGAATGCAGGTGAAGAGCATGG - Intronic
1166211457 19:41309223-41309245 TAGGAGCTGGGTTAAGAGGAAGG - Intronic
1167214666 19:48156571-48156593 TAGTGTTGTGGTTAAGAGCACGG - Intronic
925777392 2:7348365-7348387 TAGGCAGCTGGTTAAGAGGAAGG + Intergenic
929395832 2:41521182-41521204 TATTATCATGGTTTAGAGCACGG + Intergenic
930219012 2:48726665-48726687 TAGTATATTGGTTAGGAGCATGG + Intronic
930678284 2:54228521-54228543 TGGCATACTGGTTAAGAGTATGG - Intronic
931509336 2:62973443-62973465 TAGTTTAGTGGTTAAGAGCAAGG + Intronic
932580616 2:72990750-72990772 TAGCACCCTGGTTAGGAGCAAGG - Intronic
932958111 2:76379873-76379895 TAGGATCTTGGGTAAGATAATGG - Intergenic
932996397 2:76859186-76859208 AAGGATACTGGTTGAGTGCAAGG + Intronic
935547901 2:104419915-104419937 TAGGATCCAGGTAAAAAGAAAGG - Intergenic
935826565 2:106957191-106957213 TAGCATCCTATTTAAGAGCTCGG + Intergenic
936009818 2:108918387-108918409 TGGGATGCTTGTTAAGTGCAAGG + Intronic
936489077 2:112955012-112955034 TAGCATAGTGTTTAAGAGCATGG + Intergenic
936846573 2:116842123-116842145 TAGGATGCTGGAAAAGAGCTCGG + Intergenic
937943475 2:127309572-127309594 TGGGATCCTGGTTAGGATCCTGG - Intronic
939634246 2:144561590-144561612 AAGCTTCGTGGTTAAGAGCATGG + Intergenic
940178240 2:150903147-150903169 TAAAATCCTGGTTAGAAGCAAGG + Intergenic
940229991 2:151440687-151440709 TAGCATAGTGGTTAATAGCAAGG + Intronic
941192221 2:162399266-162399288 TAGGACACTGGGGAAGAGCAAGG - Intronic
941412502 2:165177242-165177264 TAGTATAGTGGTTAAAAGCATGG + Intronic
942528013 2:176876326-176876348 TAGGATGGTGGTTAAGAGTATGG - Intergenic
942789177 2:179739009-179739031 TAGGGCACTGGTTAAAAGCATGG + Intronic
943059024 2:183018365-183018387 TAACATACTGGTTAAGAGGATGG - Intronic
944125821 2:196291640-196291662 TAATGTCATGGTTAAGAGCATGG + Intronic
945817921 2:214628308-214628330 TAGCAGAGTGGTTAAGAGCATGG - Intergenic
946837116 2:223783679-223783701 ATGGATCCAGGTCAAGAGCAGGG - Intronic
947624692 2:231612337-231612359 GAGGATCCTGGTTCAGACCAGGG - Intergenic
1169227385 20:3865157-3865179 AGGCATCCTGGTGAAGAGCAAGG - Intronic
1169815407 20:9651082-9651104 TAGGGTTCTGGTTGAAAGCAGGG + Intronic
1170544842 20:17427004-17427026 AAAGATCATGGTTAAGAGCAGGG + Intronic
1171167311 20:22983464-22983486 TAGGATCCTGGAACAGAGAAAGG - Intergenic
1172986062 20:38990985-38991007 TAGGATCATGGTTAAGCACATGG - Intronic
1173219802 20:41122852-41122874 TAGTATAGTGGTTAAGAACATGG + Intronic
1173930676 20:46815474-46815496 GAGGGTCATTGTTAAGAGCACGG - Intergenic
1174164691 20:48576551-48576573 CAGGAGCCTGGATGAGAGCAGGG - Intergenic
1174246691 20:49187695-49187717 TAGCTTAGTGGTTAAGAGCACGG - Intronic
1177233564 21:18355582-18355604 GAGGGTAGTGGTTAAGAGCAGGG + Intronic
1178348346 21:31851257-31851279 GAGGATTCTGAATAAGAGCATGG - Intergenic
1183105812 22:35614283-35614305 TAGCATAGTGGTCAAGAGCAAGG + Intronic
1183749886 22:39713922-39713944 GAGGACCCTGGTTTAGAGCAGGG + Intergenic
1183780712 22:39997165-39997187 TAGCACAGTGGTTAAGAGCAAGG - Intronic
949584476 3:5424425-5424447 CAGCTTCATGGTTAAGAGCATGG + Intergenic
949622393 3:5828578-5828600 TAGATTCCTTGTTTAGAGCAGGG + Intergenic
950682156 3:14592812-14592834 GAGGATCCTGGCCAAGAACAAGG - Intergenic
950988772 3:17408029-17408051 CAGGATAGTGGTTAAGAGAATGG + Intronic
951763658 3:26172656-26172678 TAGGATCCTAGATTAGAGCCTGG - Intergenic
953162159 3:40431018-40431040 TAGGATACTGGGTAAGGGAAGGG + Intergenic
955494288 3:59515372-59515394 TGGCATCGTGGTTAACAGCAGGG + Intergenic
955609197 3:60739215-60739237 TAGGATGCTGGACAAGAGCTTGG + Intronic
956918977 3:73906232-73906254 TAGCCTCCTGGTTAAGAAGAGGG + Intergenic
957885096 3:86277085-86277107 TAGTATGGTGGTTAAGAGTAGGG - Intergenic
958130659 3:89417305-89417327 CAGAACTCTGGTTAAGAGCATGG - Intronic
958422072 3:93940733-93940755 TAGGATACTGGTGTTGAGCAAGG - Intronic
958635334 3:96737505-96737527 TATGATCCTGTCTAATAGCAAGG + Intergenic
959310002 3:104723608-104723630 TGGCCTACTGGTTAAGAGCAAGG - Intergenic
959632172 3:108519045-108519067 TAGCATCATGCTTAAGAGCAAGG - Intronic
959819310 3:110713543-110713565 TAGCATGATGGTTAAGAGCTTGG - Intergenic
960517903 3:118622637-118622659 TGGCATTGTGGTTAAGAGCATGG - Intergenic
961016527 3:123472604-123472626 TAGGGGAGTGGTTAAGAGCACGG - Intergenic
963866878 3:150370847-150370869 TAGTATGGTGGTTAAAAGCATGG + Intergenic
964513535 3:157479651-157479673 TAGCATAGTGGTTAAGAACATGG + Intronic
964869121 3:161293580-161293602 TAGCATGGTGGTTAGGAGCACGG + Intergenic
966357187 3:179093495-179093517 GAGCATCATGCTTAAGAGCATGG + Intergenic
966626354 3:182021317-182021339 TAGGGGAATGGTTAAGAGCATGG - Intergenic
968002997 3:195220448-195220470 TGGTGTCGTGGTTAAGAGCATGG - Intronic
968441017 4:624594-624616 TTGCATCCTGGTTAAAAGTATGG + Intergenic
969320592 4:6410095-6410117 TGGGATCCTGCTTCTGAGCAGGG - Intronic
970213719 4:13737076-13737098 GAAGGTTCTGGTTAAGAGCATGG + Intergenic
971956572 4:33427809-33427831 TAGCATAGTGGTAAAGAGCATGG + Intergenic
972243011 4:37214224-37214246 TTGCATCATGGCTAAGAGCATGG - Intergenic
972712433 4:41610777-41610799 TAGGGTAATGGTTAAGAGAATGG - Intronic
972994144 4:44859098-44859120 TAGTAGAATGGTTAAGAGCAAGG + Intergenic
974166821 4:58214790-58214812 CAGGACACTGGTTAAGAGCTTGG - Intergenic
974510621 4:62835623-62835645 TTAGGTCATGGTTAAGAGCATGG - Intergenic
974844139 4:67330802-67330824 TAGTATCATAGTTAACAGCATGG + Intergenic
975121061 4:70729143-70729165 TAGGATAGTGGTTAAAAGTATGG + Intronic
975198270 4:71552305-71552327 CGAGATCCTGATTAAGAGCATGG - Intronic
975913197 4:79293612-79293634 TAGCATAGTGGTTAAGAACATGG - Intronic
976579288 4:86716346-86716368 TAGTATACTGGTTATGAGCACGG - Intronic
978886866 4:113775009-113775031 GAGGATCCTGCTTATGACCAAGG + Intergenic
979318086 4:119290405-119290427 TGGCATCATGGTTAAGAGCACGG + Intronic
979773065 4:124553723-124553745 TAGGTTAGTGGTTAAAAGCATGG + Intergenic
980139078 4:128894296-128894318 TAGGGCAGTGGTTAAGAGCACGG - Intronic
980936372 4:139229392-139229414 TAGAATAGTGGTTAAGAGCCCGG - Intergenic
982055272 4:151542779-151542801 TGGCACCATGGTTAAGAGCATGG + Intronic
983274258 4:165598371-165598393 TAGCATAAAGGTTAAGAGCATGG + Intergenic
984641945 4:182176245-182176267 TAGCATACTGGTTAAGAGCGTGG + Intronic
984821888 4:183889437-183889459 TGTGATCAAGGTTAAGAGCAGGG - Intronic
985431492 4:189885611-189885633 TTGAATCCTTGCTAAGAGCAAGG + Intergenic
988548767 5:32181648-32181670 TCAGGTCCTGGTTAAGAACATGG - Intergenic
989090601 5:37726373-37726395 TAGGAACCTCTTTAAGGGCAGGG - Intronic
989260891 5:39419001-39419023 TAGATTCATGGTTAAGAGCTTGG - Intronic
989465578 5:41751461-41751483 TAGCATAGTGGTTAAGTGCATGG + Intronic
989707711 5:44357661-44357683 TAGCATAATGGTTAAGAGCAAGG - Intronic
990392632 5:55341974-55341996 TAGGATCCTAGGTAGGATCATGG + Intronic
991154262 5:63412306-63412328 TGTGATAGTGGTTAAGAGCATGG + Intergenic
991354827 5:65757310-65757332 TAGCATAGTGGTTAAGAGTATGG + Intronic
992965277 5:81993071-81993093 AAAGATAGTGGTTAAGAGCATGG + Intronic
993921534 5:93810779-93810801 TAGCATGGTGGTTATGAGCATGG + Intronic
994700350 5:103125430-103125452 CAGGCTAGTGGTTAAGAGCATGG - Intronic
995892813 5:116975145-116975167 AAGAATGCTGGTTAAGGGCAAGG + Intergenic
997212244 5:132083865-132083887 GAGGATACTGATTAGGAGCAGGG - Intergenic
997621579 5:135301877-135301899 GAGGATCCGGGTTCAGAGGAGGG + Intronic
997882314 5:137601862-137601884 GAGCACCATGGTTAAGAGCAAGG + Intergenic
998693046 5:144608933-144608955 TAGCACAATGGTTAAGAGCATGG + Intergenic
999202635 5:149826930-149826952 TAGGTTTCTGGTTCAGGGCATGG + Intronic
1000442158 5:161276899-161276921 AAGGGTCATGGTTAACAGCAAGG - Intergenic
1001314112 5:170630602-170630624 GAGGATCCTGGGAAAGAGAAAGG + Intronic
1001526475 5:172432412-172432434 AAGGATTCTTGTTAAGAGTATGG + Intronic
1001562790 5:172680344-172680366 CAGCATCCTTATTAAGAGCATGG - Intronic
1001835806 5:174831318-174831340 TAGTAGAATGGTTAAGAGCATGG + Intergenic
1003420876 6:5957549-5957571 TGGGATCCTGGATAAGATCCCGG + Intergenic
1003945883 6:11075147-11075169 GAGCAGCGTGGTTAAGAGCATGG + Intergenic
1003970904 6:11298213-11298235 TAGGATGCTGGTTAAAAATATGG - Intronic
1005610272 6:27517329-27517351 TAGGATCCTGGAACAGAGAAAGG - Intergenic
1006425481 6:33960388-33960410 CAGGACAGTGGTTAAGAGCACGG + Intergenic
1006681147 6:35797537-35797559 TTGCATCGTGGTTAAGAGTATGG + Intergenic
1007971023 6:46052561-46052583 TAGGGTCCTGGAAAAGAACAGGG - Intronic
1008771355 6:54982605-54982627 TTGTATCTAGGTTAAGAGCATGG + Intergenic
1011158283 6:84358060-84358082 TAGGATTACGGTTAAAAGCAAGG + Intergenic
1012047108 6:94291165-94291187 TAGAATGATGGTTAAGAGAAGGG + Intergenic
1012186755 6:96226654-96226676 CAGTATCATGGTTATGAGCATGG + Intergenic
1013407322 6:109855022-109855044 TAGTACAGTGGTTAAGAGCATGG + Intergenic
1016634610 6:146273221-146273243 TAGTATCCTGGTGAATAGTATGG + Intronic
1017200354 6:151746767-151746789 TAGAATAGTGGTCAAGAGCAGGG + Intronic
1017643372 6:156515806-156515828 GAGAATCCTGGCTAAGAGCTAGG - Intergenic
1017738736 6:157385807-157385829 TAGGGTACTGGTTAAAGGCATGG + Intronic
1018112183 6:160546425-160546447 AAGGATCCTGGTGAACAGCCAGG - Intronic
1018834032 6:167470174-167470196 TAGGATCCTGAGTCAGAGCAGGG + Intergenic
1020781672 7:12524112-12524134 TAGAATAGTAGTTAAGAGCATGG + Intergenic
1023125241 7:36948737-36948759 TAGGAAGGTGGTTAAGAGCATGG - Intronic
1024573171 7:50742424-50742446 TAGGATCCTGGTTAAGAGCATGG - Intronic
1026614728 7:71891436-71891458 TATCAAACTGGTTAAGAGCAGGG + Intronic
1027565704 7:79790303-79790325 AAGGAACATGCTTAAGAGCAAGG + Intergenic
1027585518 7:80053436-80053458 TGTGATTCTGTTTAAGAGCAAGG + Intergenic
1028344541 7:89763200-89763222 TAATATACTGGTTAAAAGCATGG - Intergenic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1028722856 7:94053266-94053288 TAGTACCGTGGTTAAAAGCATGG + Intergenic
1028851499 7:95543199-95543221 GAGGATCCTTGTTTAGAGAATGG - Intergenic
1029306958 7:99626579-99626601 TAGGATCCTGGCTAAGGGCCTGG + Intronic
1031393291 7:121242239-121242261 TAGCATTATAGTTAAGAGCATGG + Intronic
1033176507 7:139128708-139128730 TAGGATCCTGGTTAAGGTCGGGG - Intergenic
1033719402 7:144041691-144041713 TAGGGCAGTGGTTAAGAGCATGG + Intergenic
1034297190 7:149984529-149984551 TAGGATGCTGTTTAGTAGCAAGG - Intergenic
1034808837 7:154112315-154112337 TAGGATGCTGTTTAGTAGCAAGG + Intronic
1034903890 7:154927230-154927252 TAGGAACCTGGTGAAGATCAAGG + Intergenic
1037193108 8:16151821-16151843 TAGCAGACTGGTTAAGGGCATGG + Intronic
1037601182 8:20395438-20395460 TAAGATCTTGGCTAAGGGCAAGG + Intergenic
1037922034 8:22814274-22814296 TAGCACAGTGGTTAAGAGCAAGG - Intronic
1041962538 8:63635419-63635441 TGGGATCCTGGATAAGATCCTGG - Intergenic
1042721738 8:71833814-71833836 TAGGATGGTGGTTAAGAACATGG - Intronic
1044834716 8:96285103-96285125 TAGGAAGCTAGTTAAGACCAAGG + Intronic
1045423190 8:102037360-102037382 TTGTATGTTGGTTAAGAGCATGG - Intronic
1045528906 8:102965385-102965407 TTGAATCCTGGTGTAGAGCAGGG + Intronic
1046092204 8:109516635-109516657 TAGCATAATGGTTAAGTGCATGG - Intronic
1046445196 8:114310370-114310392 GAGGGTACTGGTTAAGAGCATGG + Intergenic
1046970130 8:120214173-120214195 TAGCATCCTGGTTAATATCATGG + Intronic
1048776433 8:137951909-137951931 TAGTATAATGTTTAAGAGCATGG - Intergenic
1050145864 9:2566771-2566793 TGGCATAGTGGTTAAGAGCAAGG - Intergenic
1050269954 9:3932634-3932656 TTGTATCATGGTTAAGAGAAGGG + Intronic
1050434889 9:5598587-5598609 TAGCATCATGGTTAAAAGCATGG - Intergenic
1053337158 9:37286181-37286203 TAGCATATTGGTTAAGAGCATGG + Intronic
1058588249 9:106533022-106533044 TTGGATGCTGGATAAGAGCTTGG - Intergenic
1059656122 9:116359137-116359159 TAGTGTCATGGTTAAGAGCCTGG - Intronic
1059730054 9:117048092-117048114 AAGGATGATGGTTAAGAGCTTGG - Intronic
1059954567 9:119502031-119502053 TTGGATCGAGGTTAAGGGCAAGG + Intronic
1185518837 X:721493-721515 TAGGAACCTGGTAAAGCTCACGG - Intergenic
1187535618 X:20139321-20139343 TTGCATAGTGGTTAAGAGCATGG - Intronic
1187664907 X:21596120-21596142 TAGCATCATGGTCAGGAGCATGG + Intronic
1188505804 X:30883497-30883519 TAGTATAGTGGTTAAGCGCATGG - Intronic
1190459542 X:50658624-50658646 TAGAATAGTGGTTAAGAACAAGG - Intronic
1190486364 X:50929005-50929027 TAGTATCGTGGTTAAGAGCAGGG - Intergenic
1190952734 X:55162103-55162125 TAGGATCCAGGTGAAGGGCCTGG - Intronic
1191879629 X:65832138-65832160 TGGTATAGTGGTTAAGAGCATGG + Intergenic
1194721229 X:97342365-97342387 TAGCTTACTGGTTAAGAACATGG + Intronic
1195751941 X:108168797-108168819 TAGCATCATGGTTAAGAGTATGG - Intronic
1195912876 X:109906197-109906219 TAGTATCACAGTTAAGAGCATGG + Intergenic
1196640923 X:118059822-118059844 TATTATAATGGTTAAGAGCATGG + Intronic
1196910173 X:120476916-120476938 TAGTGTCATGGTTAGGAGCAGGG - Intergenic
1197643963 X:128997214-128997236 TAGTATCATGGTAAAGAGCTTGG + Intergenic
1197654671 X:129104031-129104053 GAGCATAATGGTTAAGAGCATGG + Intergenic
1198526331 X:137504962-137504984 TAGGATCCTGGATCAGGGCCTGG - Intergenic
1198577036 X:138021847-138021869 TTGCATGATGGTTAAGAGCATGG + Intergenic
1198700560 X:139392911-139392933 TAGTATGGTGGATAAGAGCATGG + Intergenic
1198806050 X:140495819-140495841 TAGGATCCTGGAAAAGAAAAAGG - Intergenic
1198838331 X:140829134-140829156 TTAGATAGTGGTTAAGAGCAAGG - Intergenic
1198944907 X:142000334-142000356 TAGTATGTTGGTTAACAGCAAGG + Intergenic
1199508569 X:148593926-148593948 TAGAATCATGGTTAAAAGCTTGG - Intronic
1199634317 X:149801553-149801575 TAGGCTCCTGTGTAATAGCAGGG - Intergenic