ID: 1024574894

View in Genome Browser
Species Human (GRCh38)
Location 7:50755463-50755485
Sequence GGTGGGCTAGAACACAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024574894_1024574900 15 Left 1024574894 7:50755463-50755485 CCCACACTGTGTTCTAGCCCACC 0: 1
1: 0
2: 1
3: 10
4: 127
Right 1024574900 7:50755501-50755523 ACCAACTCCTGAGGCTCACGAGG No data
1024574894_1024574899 6 Left 1024574894 7:50755463-50755485 CCCACACTGTGTTCTAGCCCACC 0: 1
1: 0
2: 1
3: 10
4: 127
Right 1024574899 7:50755492-50755514 ACAACAGCTACCAACTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024574894 Original CRISPR GGTGGGCTAGAACACAGTGT GGG (reversed) Intronic
901150059 1:7095402-7095424 GGTGTGAGAGAACACAGTGCTGG - Intronic
903559044 1:24214264-24214286 GGTGGGAAAGAACAGAGTGCAGG - Intergenic
905210362 1:36369823-36369845 GCTGGAAGAGAACACAGTGTGGG + Intronic
907025515 1:51114244-51114266 TGTAGGCTAGAACACGGAGTTGG + Intronic
912797912 1:112704008-112704030 GATGGGTTAGAATACAGTGGTGG + Intronic
913223800 1:116680890-116680912 GGTGGGCTGGAGCTCAGTGAGGG + Intergenic
916293147 1:163188291-163188313 GCTGGGTTAGACCTCAGTGTTGG + Intronic
917098197 1:171420759-171420781 GGTGGGAGAGAATCCAGTGTAGG + Intergenic
917450461 1:175143656-175143678 GGTGGGCTGGTCCACAGTGGAGG + Intronic
920097971 1:203498909-203498931 GGGGGGCACTAACACAGTGTTGG - Intronic
924026698 1:239841039-239841061 GGTGCCATGGAACACAGTGTGGG - Intronic
1069628583 10:69883175-69883197 AGTGAGCTGGAATACAGTGTTGG + Intronic
1070556131 10:77529208-77529230 GGAGGGCAGGAACACAGTGGGGG - Intronic
1070889034 10:79928435-79928457 GGTGTCCTAGAACACAGCTTAGG - Intergenic
1071003464 10:80856499-80856521 GGTTGGCCAGCCCACAGTGTAGG - Intergenic
1071085821 10:81867743-81867765 GGTGGGGTAGCACACAGGGGAGG + Intergenic
1071144718 10:82555005-82555027 AGGGGACTAGAACACAGTGAGGG - Intronic
1071242702 10:83725787-83725809 GGTGGGCTAGGACAGGGAGTTGG + Intergenic
1072626756 10:97117017-97117039 GGAGGGAGAGAAAACAGTGTTGG - Intronic
1076314116 10:129528690-129528712 GGTGGAGTAGCTCACAGTGTTGG + Intronic
1078593719 11:12668736-12668758 GTTTGGGAAGAACACAGTGTTGG + Intergenic
1080268891 11:30429555-30429577 GGTTGGCTGGCACACAGTGAGGG - Intronic
1080932034 11:36820830-36820852 GGTGGGTGAGAACACATAGTTGG + Intergenic
1081087979 11:38824396-38824418 GGGGTGCTAGAACTCTGTGTAGG - Intergenic
1083953054 11:65967383-65967405 GGTGGGCTTGGACACGGTGGTGG + Exonic
1088418598 11:109617810-109617832 GCTGGGCTGGAATACAGTGGGGG - Intergenic
1090987912 11:131788846-131788868 GGTGGGTTTGAACACATTCTCGG + Intronic
1095583070 12:43821927-43821949 GATGGCCTAGAACACTATGTTGG + Intergenic
1095625114 12:44304985-44305007 AGTGGGGTAGAGCACAGAGTTGG + Intronic
1096461825 12:51825914-51825936 GGTGGTCTAGATAAGAGTGTCGG - Intergenic
1102552191 12:113699621-113699643 GGTGGGCTAGATCACAAAATTGG + Intergenic
1102980441 12:117236906-117236928 GGTGGGCTAGAATGCAAGGTGGG + Intronic
1104678602 12:130732703-130732725 GGTGGGGAAGAGCACAGTGGTGG - Intergenic
1108478854 13:50846639-50846661 GGTGAACTAGAATTCAGTGTAGG + Intergenic
1108992871 13:56685261-56685283 GTGTGGCTAGAACACAGTGTTGG + Intergenic
1111929566 13:94499773-94499795 GAAGGGCTGGAACACAGGGTTGG - Intergenic
1113573225 13:111373477-111373499 GGTGGGTTTGACCACAGGGTGGG - Intergenic
1113658179 13:112083445-112083467 GATGGGCTTGAACAAAGCGTGGG - Intergenic
1114287559 14:21259613-21259635 GGTGGACAAGAACACAGATTTGG - Intronic
1118910584 14:70059014-70059036 GTTGGGCAAGAATACAATGTGGG + Intronic
1119643948 14:76335106-76335128 GGTGGGCCAGGACCCAGTGGTGG - Intronic
1121244413 14:92451770-92451792 GGTGGCCTTGAACACAGCCTGGG + Intronic
1121253988 14:92518405-92518427 GGTGGCCTAGATCACAGGGCGGG + Intronic
1129313060 15:74725693-74725715 GGTGGGCAAGAACCCACTATGGG + Intergenic
1129335477 15:74849900-74849922 TGAGGGCTAGATCACAGTGAGGG + Intronic
1129635349 15:77311131-77311153 GGTAGCCTAGAACAAAGTGGTGG + Intronic
1130088411 15:80797863-80797885 AGTGGCCTAAAACACAGTGGAGG - Intronic
1130652434 15:85769705-85769727 GGTGGGCCAGCACACAGTCCGGG + Exonic
1133356710 16:5142151-5142173 GGTGAGGAAGAACACAGTCTTGG + Intergenic
1136229320 16:28877561-28877583 CGTTGGTTAGAGCACAGTGTGGG + Intergenic
1136576828 16:31130203-31130225 GGTGGGCATGAACAGAGAGTGGG + Intronic
1143106812 17:4534278-4534300 GCTGGGCTAGAGCCCATTGTTGG - Intronic
1143192287 17:5048790-5048812 GCTGGGCTACAACCCAGTGGAGG + Intronic
1143462696 17:7114346-7114368 GGTGGGATGGAACGCAGGGTCGG + Exonic
1144783242 17:17818152-17818174 GGTGGGCCAGAACCAAGGGTGGG + Intronic
1146647603 17:34585401-34585423 GGTGGGCCAGACCCCAGTGGTGG - Intronic
1146911261 17:36649844-36649866 GGTGGGCTGGGACAGAATGTGGG + Intergenic
1146953655 17:36923302-36923324 GGTGGCCTTGAACATAGCGTAGG - Intergenic
1148645353 17:49217112-49217134 TGTGCGCTAGAACACTGTGGCGG - Intronic
1149304785 17:55336920-55336942 GGTGGGTTAGCCCATAGTGTAGG + Intergenic
1151142818 17:72011226-72011248 GATGGGCTAAGACACTGTGTTGG - Intergenic
1152390708 17:80002156-80002178 GGTGGGCCAGGACCCAGTGCTGG - Intronic
1152574907 17:81135713-81135735 CGTGAGCTAGAAGACAGTGAGGG + Intronic
1155354867 18:24942346-24942368 TGTGGGAAAGAACACAGGGTTGG - Intergenic
1158708753 18:59818378-59818400 AGTGGTCTAGCACACAGTGGAGG + Intergenic
1158902094 18:61973459-61973481 GGTGGGGCAGAACACAGAGGAGG - Intergenic
1159862016 18:73660616-73660638 GGTGGGCTTGTATACAGTTTGGG - Intergenic
1161007012 19:1941874-1941896 GGTGGGCTTGAGCACTGGGTGGG - Intronic
1161706382 19:5824071-5824093 GCTGGGCCAGGACTCAGTGTGGG - Exonic
1167533248 19:50032057-50032079 TGTGTGCTAGACCACATTGTGGG - Intronic
925138709 2:1536159-1536181 GGGGGGCTTGAACACATTGGGGG - Intronic
925208572 2:2027319-2027341 GGTGGGCTACAACACAGAGTAGG - Intronic
926164447 2:10511192-10511214 GGTGGCCTAGACCAATGTGTGGG + Intergenic
926312767 2:11686426-11686448 GGAGGGCTAGAACGCTGGGTTGG + Intronic
927826680 2:26314267-26314289 GATGGGGTAGAAAACAGTGTTGG + Intronic
929568886 2:43007223-43007245 AGTGGCCTAGAAAGCAGTGTGGG - Intergenic
929931153 2:46256514-46256536 GTGTGGCTAGAACACAGTGAAGG - Intergenic
935756512 2:106280260-106280282 GGACGGCAAGAACCCAGTGTTGG - Intergenic
938946611 2:136217913-136217935 GGTGGGGTGGAACACACAGTGGG + Intergenic
940254578 2:151715133-151715155 GGTGGGCAAGGTGACAGTGTTGG - Intronic
946022849 2:216653492-216653514 GGTGGGCCAAAAGACAATGTAGG + Intronic
1170620692 20:17993453-17993475 GGTGGGCAGGAACACAGGGTAGG - Intronic
1170625096 20:18024364-18024386 GATGGCCAAGAACACCGTGTGGG - Exonic
1172779578 20:37428006-37428028 GGAGGTCCAGATCACAGTGTTGG - Intergenic
1174340616 20:49892847-49892869 GGTGGGCTGAAGCACAGTGTGGG - Intergenic
1174348300 20:49948157-49948179 GGGGAGCTAGAACATAGGGTGGG - Intronic
1175122869 20:56729878-56729900 AGTGGGCTAGCACATAGTGCAGG + Intergenic
1179670384 21:42942839-42942861 GGAGGGGTGGGACACAGTGTGGG + Intergenic
1181590019 22:23878329-23878351 GCTGGGCTAGTTCACAGTGTGGG + Intronic
1182079110 22:27516672-27516694 GGTGGCTTAGAATACAGTGGTGG - Intergenic
949122564 3:404251-404273 GGTGGCATATAACACAGAGTAGG + Intronic
949580553 3:5383795-5383817 GCTGAGCTAGAGCACTGTGTCGG + Intergenic
949679796 3:6499610-6499632 GGTGAGCAAGAACACAGACTTGG - Intergenic
950545085 3:13633476-13633498 GGTGGGCAAGGGCACAGTGGGGG + Intronic
955512525 3:59695674-59695696 GCTGTGCTAGACCACAGTGCTGG + Intergenic
956659825 3:71585876-71585898 TGTGTGCTAGACCACAGAGTGGG + Intergenic
960364043 3:116749138-116749160 GGTGGGAAAGAACACAGGGGAGG + Intronic
965530951 3:169769360-169769382 GGCGGGCTAGAACTCTGCGTGGG - Exonic
969808430 4:9628682-9628704 GGTGAGTAAGAACACAGTCTTGG - Intergenic
972408209 4:38766358-38766380 GGTGGCCTGGAAAGCAGTGTAGG - Intergenic
974528819 4:63080688-63080710 GAGGGGGTAGGACACAGTGTTGG - Intergenic
981217998 4:142194516-142194538 GGTAGACTAGAACATAATGTTGG - Intronic
983663375 4:170154808-170154830 TGTGGGCTAGCTCACAGTGGTGG + Intergenic
987431260 5:17836358-17836380 GGTGGGCAACAACACACAGTGGG - Intergenic
992692717 5:79256407-79256429 GGTGGGGTAGAACACCAAGTGGG - Intronic
992974147 5:82095674-82095696 GGTGGGCTAAGACACACTGAAGG - Intronic
994085566 5:95754403-95754425 GGTGGACTGGAATACAGTGCAGG + Intronic
999127067 5:149253690-149253712 GGTGGGCCAGAACATGGTGCTGG + Intronic
999435956 5:151563464-151563486 GGAGGGGTAGAACACAGCTTGGG + Exonic
999698920 5:154210199-154210221 GGTGGGTGAGGGCACAGTGTGGG - Intronic
1002663633 5:180807314-180807336 GGAGGGGTAGAGCACAGTGTTGG - Intronic
1006079885 6:31559046-31559068 GGTGGACAAGACCCCAGTGTAGG - Intergenic
1006103115 6:31699061-31699083 GGTGGGGGAGAACAGAGTGGGGG - Intronic
1007747942 6:44054740-44054762 GGTGAGCAAGAACCCAGAGTAGG - Intergenic
1009698918 6:67149003-67149025 AGTGTGCTAGAGCAGAGTGTTGG + Intergenic
1013904951 6:115204771-115204793 GGTAGGCGACAACAGAGTGTAGG + Intergenic
1014483743 6:121972904-121972926 AGTGGTCTAGACCACTGTGTGGG - Intergenic
1016150080 6:140729693-140729715 GGTGGGGTACAAAACAATGTAGG + Intergenic
1018231203 6:161677415-161677437 GATGAGCTAGAACTGAGTGTCGG + Intronic
1021606545 7:22414594-22414616 GCTGGGCAGGAACACAGTGTGGG - Intergenic
1022377129 7:29824616-29824638 GGAGGCCCAGAACACAGTGGAGG + Intronic
1024574894 7:50755463-50755485 GGTGGGCTAGAACACAGTGTGGG - Intronic
1027740698 7:82000478-82000500 AGTGCTCAAGAACACAGTGTTGG + Intronic
1029592683 7:101517723-101517745 GCTGGGCTGGAAGACAGGGTTGG + Intronic
1032546458 7:132747880-132747902 GGTGGGCTAGGAGACAATGGAGG - Intergenic
1032745017 7:134777786-134777808 GCTGGGCTTGAACATATTGTAGG - Intronic
1038703618 8:29874071-29874093 GGTGGGGGAGATCACAGTGGGGG + Intergenic
1040844510 8:51823000-51823022 GCTGGAATAGCACACAGTGTTGG - Intronic
1043282495 8:78485501-78485523 GGTAGGGTAGCAGACAGTGTTGG - Intergenic
1043291909 8:78612475-78612497 GATGGGCTAGAGCAAAATGTTGG - Intergenic
1045714615 8:105026584-105026606 GGTGGGCAAGAACCCAATCTTGG + Intronic
1051716812 9:19993667-19993689 GATGGGGTAGAACTCTGTGTGGG - Intergenic
1061405610 9:130391649-130391671 CGTGGCCCAGGACACAGTGTGGG - Intronic
1186466067 X:9785817-9785839 GGTGCGCGAGAACAAAGTGTGGG + Intronic
1186798057 X:13065714-13065736 GGGGGCCAAGAACAAAGTGTTGG - Intergenic
1189988569 X:46574541-46574563 GGTGCGCCAGGACACAGTGGCGG - Exonic
1192124634 X:68490678-68490700 TGTGAGATAAAACACAGTGTAGG - Intergenic
1199606142 X:149581173-149581195 GGTGCGCTTGAACACAGTGCAGG - Intergenic
1199632979 X:149788195-149788217 GGTGCGCTTGAACACAGTGCAGG + Intergenic