ID: 1024575872

View in Genome Browser
Species Human (GRCh38)
Location 7:50763811-50763833
Sequence GCTGAGTCCCAGTTCAGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 159}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024575872 Original CRISPR GCTGAGTCCCAGTTCAGATG AGG (reversed) Intronic
900974927 1:6011076-6011098 GCTGAGTCCCAGGTCTGAACGGG - Intronic
901616490 1:10544001-10544023 GCTGAGTCCGTCTTCAGGTGTGG + Intronic
904054044 1:27658763-27658785 GGTGGGTCTCAGTTCAGCTGAGG - Intergenic
905172724 1:36118636-36118658 GCTAAATCCCAGACCAGATGTGG + Intronic
909848314 1:80426758-80426780 ACTGAGGCACAGTTCAGATATGG + Intergenic
911055155 1:93702411-93702433 GCTCAGGCCCAGGTCAGAGGAGG + Intronic
912255426 1:108053432-108053454 GCTGGGTTTCAGTTAAGATGAGG + Intergenic
913691430 1:121283202-121283224 GCTCAGTTTCAGTTCAGGTGAGG + Intronic
914146115 1:144996780-144996802 GCTCAGTTTCAGTTCAGGTGAGG - Intronic
915898815 1:159831545-159831567 GCTGAGACTCAGATCAGAGGAGG - Intronic
920478756 1:206301679-206301701 GCTCAGTTTCAGTTCAGGTGAGG + Intronic
1063478526 10:6349895-6349917 GCTGAGTCCCAGCACAGAGTGGG - Intergenic
1064462863 10:15551696-15551718 ACTGAATCCCATTTCTGATGAGG - Intronic
1067217306 10:44313870-44313892 GCTGACTGACAGTTCAGAAGTGG + Intergenic
1068340252 10:55692630-55692652 GCTGATTCACAGGTCAAATGTGG + Intergenic
1072108184 10:92293007-92293029 GTTGAGACCCTGTTCTGATGTGG + Intronic
1073380257 10:103072796-103072818 GCTGACCCCCAGTTCAGGTCAGG - Intronic
1075637667 10:124040622-124040644 GCTGAGTCACATTTCAGAGCTGG + Intronic
1075680590 10:124328504-124328526 GCCCAGTCTCTGTTCAGATGAGG + Intergenic
1075887594 10:125914922-125914944 GCTCACTCTCAGATCAGATGGGG - Intronic
1077186559 11:1238102-1238124 GCTGAGCCCAGGTTCAGATGGGG + Intronic
1078581621 11:12543439-12543461 GCTGAGCCCCAGGACAGAAGAGG + Intergenic
1078849263 11:15149266-15149288 CCTCAGTCACGGTTCAGATGGGG - Intronic
1079011066 11:16828747-16828769 GCTGACTCCCTGTCCAGCTGAGG + Intronic
1079100223 11:17536704-17536726 GCTGAGTCCCACTTGGGATGTGG - Intronic
1081531470 11:43962879-43962901 TCTGACACCCACTTCAGATGAGG + Intergenic
1083710752 11:64546829-64546851 GCTCAGGGCCAGGTCAGATGTGG + Intergenic
1084929856 11:72546341-72546363 GCTGGGTCCTACTTGAGATGGGG + Intergenic
1086490399 11:87353249-87353271 TCTAAGTCCCAGATCAGACGGGG + Intergenic
1090206564 11:124887537-124887559 GCTGAGCTCCAGAGCAGATGGGG - Intronic
1090310562 11:125732997-125733019 GCTGAGTCCCTGGTCATTTGGGG - Intergenic
1091352393 11:134907685-134907707 GCTGAGTCCCAGTTTCTCTGTGG - Intergenic
1092758010 12:11783115-11783137 GGTGAGTGGCAGATCAGATGAGG + Intronic
1094043941 12:26146523-26146545 GTTGAGTCCCAGTTGTGGTGTGG - Intronic
1097782222 12:63721214-63721236 GCTGGATCCTAGTTCAGAGGGGG + Intergenic
1104649685 12:130522636-130522658 GCAGAGTCCAAGTGCAGGTGGGG + Intronic
1104651859 12:130540562-130540584 GGTGAGTCACTGTCCAGATGCGG - Intronic
1105255816 13:18743565-18743587 AGGGAGTCCCACTTCAGATGTGG - Intergenic
1105847829 13:24308386-24308408 CCTGAGTCCCAGCTCCGCTGGGG - Intronic
1106340656 13:28823596-28823618 GTTGAGGCCCAGTTGAGAAGAGG - Intronic
1106911135 13:34464828-34464850 TCTGACTCCCACTACAGATGAGG + Intergenic
1109257279 13:60098380-60098402 GCAGAATCCTAGTTCTGATGAGG + Intronic
1113549935 13:111184930-111184952 CCTGTGTCACACTTCAGATGGGG + Intronic
1121616220 14:95315479-95315501 GCGGAGTCCAAGTTCGCATGAGG + Intronic
1122114081 14:99518959-99518981 GCTGAGTTCTAGTACAGGTGGGG - Intronic
1123120652 14:105914873-105914895 AGTGAGGCCCAGGTCAGATGAGG + Intergenic
1125490649 15:40146166-40146188 CCTGAGTACCGGTTCAGGTGTGG + Intergenic
1128155442 15:65388944-65388966 GCTCAGTCGCAGGTCGGATGGGG + Exonic
1129109949 15:73331390-73331412 GCAGACTCCCAGGTCATATGTGG - Intronic
1130069823 15:80636964-80636986 GCTGAATGCCAGTTCTGAAGCGG + Intergenic
1130991683 15:88879431-88879453 GCTGAGTCCCAGGAGAGAGGCGG - Intronic
1132437533 15:101821455-101821477 GTAGAGTCCTAGTTCAGATCAGG + Intergenic
1133089212 16:3390412-3390434 GCTGGGTCCCAGGTGAGCTGTGG - Exonic
1135879608 16:26241132-26241154 GTTGAGTGCCAGCTCAGCTGCGG + Intergenic
1136017084 16:27407372-27407394 GCGTAGACCCAGTTCAGATAGGG + Intronic
1141687455 16:85578410-85578432 GCTGGTTCCCATTTCACATGTGG + Intergenic
1141817612 16:86423532-86423554 GCTGTAACTCAGTTCAGATGGGG + Intergenic
1143795239 17:9330762-9330784 GCTGAGCCCCTATTCAGAGGGGG + Intronic
1144248016 17:13386872-13386894 CCTGAGCCCCTGTTCAGATTTGG + Intergenic
1144487671 17:15680854-15680876 GCAGAGTCCCAGGTGAGTTGGGG - Exonic
1144907785 17:18650415-18650437 GCTGACTCCGAGTTCTGCTGTGG - Intronic
1144913354 17:18701434-18701456 GCAGAGTCCCAGGTGAGTTGGGG + Exonic
1146184840 17:30718001-30718023 GCTGAGTCCAAGTCCAGTTAGGG + Intergenic
1149994808 17:61400836-61400858 TCTGAGTCCCAGCGCAGAGGAGG + Intronic
1156281050 18:35638850-35638872 GCTGAGTTCAACTGCAGATGTGG + Intronic
1158196065 18:54886166-54886188 GATGAGTACTATTTCAGATGGGG - Intronic
1161051867 19:2168366-2168388 GCTGAGTACAAGGTCAGCTGAGG + Intronic
1164089146 19:21932427-21932449 ACTGAGACCCAGTTCACAGGAGG + Intergenic
1165408134 19:35642991-35643013 GCGGAGCCCCAGTCCAGCTGTGG - Exonic
1166302439 19:41919539-41919561 TCTGAGTCTGGGTTCAGATGTGG - Intronic
1166339992 19:42131767-42131789 GATCAGTGCCAGTTTAGATGGGG + Intronic
925422575 2:3724860-3724882 GCTGAGTCCCAGGGCAGAGCTGG + Intronic
925628160 2:5862699-5862721 ACGGAGTCCCTGTTCAGGTGAGG + Intergenic
937843374 2:126550777-126550799 GCTGGGTCACAGATGAGATGTGG - Intergenic
938072406 2:128315647-128315669 GCTGGGTCCCTGGGCAGATGGGG + Intronic
938086696 2:128406543-128406565 GCTGAGGCCCAGGGCTGATGTGG + Intergenic
943049112 2:182894277-182894299 GCAGAGTCCCTGTTTGGATGCGG + Intergenic
944635976 2:201676451-201676473 GCTGAGCCCCATTTCAAAAGTGG - Intronic
946946664 2:224828951-224828973 CCTGAGTCACAATTCAGATCTGG + Intronic
947289942 2:228561874-228561896 ACTGACTCCCAGTTCAGCAGGGG + Intergenic
947995269 2:234522351-234522373 GCTGAGGCCACGTTCAGAGGTGG - Intergenic
948403799 2:237702805-237702827 GCTGAGTCCCATCCCAGATCTGG - Intronic
1169589307 20:7122476-7122498 GCTGAGGCTCAGATCAGGTGAGG + Intergenic
1171372733 20:24672281-24672303 TTTGAGTTCCATTTCAGATGTGG - Intergenic
1172528466 20:35615505-35615527 ACTGAGTGCCATTTTAGATGGGG + Intergenic
1175898738 20:62351666-62351688 GGTGAGGCCCCGTTCAGGTGAGG - Intronic
1176082537 20:63281245-63281267 CCTGGGTCCCAGTCCTGATGTGG + Intronic
1177844146 21:26269057-26269079 ACTGAGTCTCAGTCCAGATGAGG + Intergenic
1178478717 21:32960119-32960141 TCTGAGTCCCAGTTAATATTGGG - Intergenic
1179494453 21:41763005-41763027 GCTTAGGCACAGTTCAGAGGGGG + Intronic
1181876521 22:25944865-25944887 GCTGAGTTAGAGTTCAGAAGAGG + Intronic
1182110509 22:27719803-27719825 GCTGAGTCCAAAGTCAGAAGAGG + Intergenic
1182842537 22:33403325-33403347 GCAGAGTCCTAGTGCAGAAGAGG + Intronic
1183648651 22:39141195-39141217 ACTGAGTCCCAGGGCAGCTGAGG - Intronic
1184034318 22:41911253-41911275 GCTGTGTCCAGGTGCAGATGGGG - Exonic
1184876894 22:47282024-47282046 GCTGAGGCCCAGCCCTGATGAGG + Intergenic
949373962 3:3366419-3366441 GCTAAGTGCCAGCTCTGATGTGG - Intergenic
950026189 3:9821431-9821453 GCTGTGTCCCAGTTGAGAACAGG - Intronic
950664044 3:14484146-14484168 GTTGAGTCCCAGTTCTGACATGG + Intronic
952418210 3:33108538-33108560 GGTGAGTCCCAGTGCATATTTGG + Intergenic
955215991 3:56985527-56985549 GCAGAGCCCCAGTTCAGGGGTGG - Intronic
958057762 3:88435005-88435027 CCTTAGTCCCATGTCAGATGTGG + Intergenic
961842520 3:129727957-129727979 GCTGACTCTGAGTTCAGCTGTGG - Intronic
962353045 3:134669608-134669630 ACTGAGTCACAGTTCTCATGGGG - Intronic
962362762 3:134755607-134755629 ACTGAGCCCCAGTCCAGAAGAGG - Intronic
962413060 3:135158297-135158319 GCTGACTCCTGGTTTAGATGAGG - Intronic
967436054 3:189447727-189447749 CCTGAGGCCCAATTCTGATGGGG + Intergenic
968892164 4:3375187-3375209 GCTGAGTCTTGGTTCATATGAGG + Intronic
968915932 4:3497098-3497120 GGTGAGTCCCAGCCCAGGTGTGG + Intronic
969328978 4:6461995-6462017 GCTCACCCCCAGCTCAGATGTGG + Intronic
972349173 4:38220476-38220498 TCTAAGTCCAAGTGCAGATGAGG + Intergenic
975346705 4:73300065-73300087 GCGGAGTTCCTGTTCAGGTGTGG + Intergenic
975416649 4:74112568-74112590 ACAGAGTCCCTGTTCAGATGTGG + Intergenic
976162136 4:82213618-82213640 GCTGAGTGACAGCTCAGAGGAGG + Intergenic
976165002 4:82245111-82245133 GCTGAGATAGAGTTCAGATGGGG - Intergenic
980268064 4:130545864-130545886 GGTGAGTCTTGGTTCAGATGAGG + Intergenic
982017895 4:151174184-151174206 GCTGAGGCCCATTTCATCTGAGG + Intronic
982566385 4:156992307-156992329 CATGAGTCCCATTTCGGATGAGG + Intergenic
989637797 5:43555930-43555952 GCTGACTCCGAGTTCTGCTGTGG + Exonic
989782328 5:45283018-45283040 TCTTAGACCCAGTTCAGATATGG - Intronic
997006268 5:129820061-129820083 TCAAAGTCCCAGTTCAGTTGAGG + Intergenic
997695138 5:135855727-135855749 TATGAGTCCCAGCTCAGCTGGGG - Intronic
998049935 5:139023767-139023789 CCCGAGTCCCAGTTGTGATGGGG - Intronic
998097205 5:139402836-139402858 GCTGAGTCTCAGTTTATCTGTGG - Intronic
998390230 5:141782802-141782824 GCTGGGTCCCTGTAGAGATGGGG + Intergenic
1000908119 5:166988339-166988361 GCTGAGTCAAAGTTGAAATGGGG - Intergenic
1003832794 6:10033192-10033214 CCTGAGACCCAGTGCAGAAGTGG + Intronic
1005925958 6:30445927-30445949 GCTGAGTCTCAATAGAGATGAGG - Intergenic
1007307123 6:40915769-40915791 GCTGACTTGCAGTACAGATGGGG - Intergenic
1007707281 6:43798607-43798629 TGTGAGTCCCAGATCAGAGGAGG + Intergenic
1008887416 6:56446085-56446107 GCTGAGGCCCCTTTCAAATGTGG - Intergenic
1008913137 6:56758221-56758243 GCTATGTTCCAGTTCAGCTGTGG + Intronic
1011399009 6:86939258-86939280 GCTGAGTCCCACTTAGGAGGTGG - Intronic
1014865923 6:126530037-126530059 GCAGAGTCCCAGATCATATTGGG + Intergenic
1016566368 6:145459263-145459285 GCTGAGGCCTAGTTGAGAAGAGG + Intergenic
1017013968 6:150085009-150085031 ACTGAGAGCCAGTTCAGCTGCGG - Intergenic
1018066932 6:160131109-160131131 TCTGAGGCCCAGCTCAGAGGTGG + Intronic
1018746181 6:166764186-166764208 GCTGAGCCCCAGCTCAGAGCTGG + Intronic
1018945598 6:168345550-168345572 GCTGAGTCCCAGTGCTTGTGGGG + Intergenic
1019131739 6:169882070-169882092 GCAGAGACCAAGCTCAGATGAGG + Intergenic
1022813561 7:33892556-33892578 CCTGCTTCCAAGTTCAGATGAGG + Intergenic
1022940815 7:35237314-35237336 GCTGGATCCTAGTTCAGAGGGGG + Intronic
1024575872 7:50763811-50763833 GCTGAGTCCCAGTTCAGATGAGG - Intronic
1024842594 7:53603853-53603875 GCTCAGGCACAGTTCAGGTGAGG + Intergenic
1025260973 7:57417165-57417187 GCTGAGACCTGGGTCAGATGAGG - Intergenic
1025738285 7:64174375-64174397 GCTGAGACCTGGGTCAGATGGGG - Intronic
1028907971 7:96175999-96176021 TCTGAGGCCCACTACAGATGTGG + Intronic
1030270077 7:107661191-107661213 GCTGCGTCCCGGGTCAGGTGCGG + Intronic
1035663944 8:1366453-1366475 GCTGCCCCCCACTTCAGATGGGG - Intergenic
1038242701 8:25824428-25824450 TCTGAGCCTCAGTACAGATGTGG - Intergenic
1041369463 8:57143469-57143491 GCTGAGTCCCAGCCCCGCTGCGG - Intergenic
1042783914 8:72525035-72525057 GTTGACTCCCATTTCAGAGGAGG - Intergenic
1048292502 8:133191493-133191515 CCTGACTCCCAGTTCTGCTGAGG - Intronic
1051152194 9:14094435-14094457 GTTGAGTTCCACTTCAGATGAGG + Intronic
1054712428 9:68524676-68524698 GATGAGTCCCACATCAGATGAGG - Intronic
1055350617 9:75383202-75383224 GCTGAGGCCTAGTTCTGATACGG - Intergenic
1056548239 9:87630583-87630605 GATGTGTGCCATTTCAGATGCGG - Intronic
1058323263 9:103660354-103660376 TCTGAGTCCTAGTTCAGAGATGG - Intergenic
1059752618 9:117262536-117262558 CCTGAGTCTCAGTTCAGGAGTGG + Intronic
1185615386 X:1418831-1418853 GCTGAGTCCCAGATCATGGGTGG - Intronic
1189400889 X:40667559-40667581 GGTGGGTCCCAGATCACATGGGG + Intronic
1193433840 X:81447223-81447245 GCTGAGTTCCAGCAAAGATGCGG - Intergenic
1195289928 X:103422891-103422913 GGTGAGTCCCAATGCAGATATGG - Intergenic
1195646279 X:107234048-107234070 GGTGAGTGCCAGTGGAGATGTGG + Intronic
1198176734 X:134163879-134163901 GATGGGTTCCAGTTAAGATGAGG + Intergenic
1199808793 X:151328601-151328623 TATGAGTCCCTGTTCAGAGGAGG + Intergenic