ID: 1024576148

View in Genome Browser
Species Human (GRCh38)
Location 7:50766204-50766226
Sequence TCACAAGGGACCCTGAGTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 92}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024576148_1024576153 0 Left 1024576148 7:50766204-50766226 CCTATACTCAGGGTCCCTTGTGA 0: 1
1: 0
2: 0
3: 10
4: 92
Right 1024576153 7:50766227-50766249 TCCCCCTCTGCCCTTGTGGAGGG 0: 1
1: 0
2: 1
3: 21
4: 215
1024576148_1024576151 -4 Left 1024576148 7:50766204-50766226 CCTATACTCAGGGTCCCTTGTGA 0: 1
1: 0
2: 0
3: 10
4: 92
Right 1024576151 7:50766223-50766245 GTGATCCCCCTCTGCCCTTGTGG 0: 1
1: 0
2: 0
3: 11
4: 114
1024576148_1024576152 -1 Left 1024576148 7:50766204-50766226 CCTATACTCAGGGTCCCTTGTGA 0: 1
1: 0
2: 0
3: 10
4: 92
Right 1024576152 7:50766226-50766248 ATCCCCCTCTGCCCTTGTGGAGG 0: 1
1: 0
2: 1
3: 6
4: 155
1024576148_1024576160 19 Left 1024576148 7:50766204-50766226 CCTATACTCAGGGTCCCTTGTGA 0: 1
1: 0
2: 0
3: 10
4: 92
Right 1024576160 7:50766246-50766268 AGGGCTCCCCCTCCCTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024576148 Original CRISPR TCACAAGGGACCCTGAGTAT AGG (reversed) Intronic
904465526 1:30705057-30705079 ACCCAAGGGCCCCTGAGAATGGG + Intergenic
904892890 1:33792618-33792640 TCACCAGTGACTCTGAGCATTGG - Intronic
905364588 1:37443138-37443160 ACAATAGGGACCCTGAGAATGGG - Intergenic
915610256 1:156986248-156986270 TCAAAAGGGGCCCTGAGTCTTGG + Intronic
918161534 1:181905379-181905401 TCACTAGGGACCCTGAAGTTAGG + Intergenic
918198372 1:182243933-182243955 TCACAAGTGACCATGACAATAGG + Intergenic
921178517 1:212613723-212613745 TCCCAAGGGACAATGAGTATAGG - Intronic
922410066 1:225364809-225364831 TGACAATAGACCCTGAGTTTCGG + Intronic
1066683800 10:37961170-37961192 TCACCAGGGTCCCTAAATATGGG + Intronic
1072053045 10:91725399-91725421 CCAGAAGGGACACAGAGTATTGG - Intergenic
1077358283 11:2128544-2128566 TTTCAAGGGTCCCTGAGCATGGG - Intergenic
1078021107 11:7656573-7656595 TCCCAAGAAACCCTGAGTATTGG - Intronic
1079078318 11:17397109-17397131 CCACAAGGGAGCCTGGGGATGGG - Intronic
1079340647 11:19608999-19609021 TCACAAGGGACCTTAAAGATGGG - Intronic
1080848897 11:36050678-36050700 TCTAAAGGGACACTCAGTATAGG - Intronic
1083266404 11:61548891-61548913 TCACAGGGGACTCTGTGTACAGG + Intronic
1084903477 11:72327874-72327896 TCACAAGGGCCCCCGGGGATGGG + Intronic
1088193152 11:107248628-107248650 TAACCATGGACCCTGACTATTGG - Intergenic
1088777131 11:113096328-113096350 TGACAAGGGAGCCTGAGGAAGGG + Intronic
1090887762 11:130894157-130894179 TCACAGGAGACCCTGAATATAGG + Intronic
1098608702 12:72427279-72427301 CTACAAGGGGCCCTGATTATGGG + Intronic
1102023524 12:109700014-109700036 TCACAAGGTACCTTGGGAATTGG - Intergenic
1103218697 12:119224949-119224971 TCTCAAGGGAACCAGAGTTTGGG - Intergenic
1104724093 12:131065604-131065626 TCAAAAGGGACCCAGAGCCTGGG - Intronic
1104802884 12:131566703-131566725 TCAAAAGGGACCCAGAGCCTGGG + Intergenic
1107959835 13:45548031-45548053 CCACCAGGGACCCTGAGTTTGGG + Intronic
1112491139 13:99865435-99865457 TCACAAGGGATGGTGAGAATCGG - Intronic
1115310448 14:31973925-31973947 TCTCAGGGGTCCCTGAGTCTGGG - Intergenic
1118352325 14:64981948-64981970 TGACAAGGTACCCAGTGTATGGG - Intronic
1122819235 14:104332942-104332964 TCACAAGGGACCATGAGCCCAGG + Intergenic
1124239351 15:28017114-28017136 TCACAAAGGACACTGAAAATAGG + Intronic
1127321384 15:57849926-57849948 GCTCAAGGTACTCTGAGTATGGG + Intergenic
1130702717 15:86201720-86201742 TCCCAAGGGGTCCTGAGAATTGG - Intronic
1130967683 15:88709396-88709418 TCACTCTGGACCCAGAGTATAGG - Intergenic
1135984326 16:27172976-27172998 CCACAAAGGACCATGAGTTTGGG + Intergenic
1144360269 17:14485567-14485589 ACACAAGGCAGCCTGAGGATCGG - Intergenic
1146524168 17:33551919-33551941 TCACAAAGGAGCCTGAGGCTGGG + Intronic
1146558078 17:33844322-33844344 TCACAAGGAACCCTTAATTTGGG - Intronic
1147053385 17:37815096-37815118 ACAAAGGGGTCCCTGAGTATAGG - Intergenic
1153195337 18:2589619-2589641 TCACAAGAAGCCCTGAGTTTTGG + Intronic
1161108440 19:2455848-2455870 TCACGGGGGACCCTGAGCAGGGG - Intronic
1161607055 19:5220966-5220988 TGACAAGGAACCCGGAGCATGGG + Intronic
1162071523 19:8155144-8155166 TCACAAGAGACCCTGAAGACAGG + Intronic
1163373766 19:16917362-16917384 TCACATGGGAAGCTGTGTATGGG + Intronic
1163518756 19:17779801-17779823 GCACAGTGGACCCTGAGTGTGGG + Intronic
1167712274 19:51119775-51119797 TCACAAGAGTCCCTCCGTATGGG - Intergenic
926490122 2:13515351-13515373 TCACAAGGAACTCTTAGTATAGG - Intergenic
927874762 2:26648003-26648025 TCACCAGGGAGCCTGAGTGAGGG + Intergenic
935580232 2:104750214-104750236 TCACTAGGTACCCTGAGGATAGG + Intergenic
942003192 2:171671313-171671335 TCACAAGGGTCCCTAAATATGGG + Intergenic
949049467 2:241889415-241889437 TCAAAAGTGGCCCTAAGTATGGG + Intergenic
1170559250 20:17541950-17541972 TCTCAAGGTAACCTGAGTTTTGG + Intronic
1170874472 20:20237293-20237315 TCGTAAGGTACCCTGAGTCTGGG - Intronic
1173671136 20:44799650-44799672 TCACTAGGGACACTGAGTGCTGG + Intronic
1173752850 20:45490285-45490307 GCACAGGGGACCCTGAGCAGGGG + Intergenic
1176244328 20:64090311-64090333 TCACACGTGTCCCTGAGTCTTGG + Intronic
1180062315 21:45391838-45391860 ACACAAGGAACCCTGAGAAGTGG - Intergenic
1182324859 22:29504838-29504860 TAACAAGGATCCCTGGGTATAGG - Intergenic
950282829 3:11721383-11721405 TCACAAGGGGCCCCAAGTTTCGG - Intergenic
951824064 3:26847538-26847560 TCACAAGGGATCCTGGGAAATGG + Intergenic
955365257 3:58305197-58305219 TCACAAGGGACACTGAGAGTGGG + Intergenic
959856648 3:111166501-111166523 TCAGATAGGACCCTGAGTTTAGG + Intronic
960248009 3:115420963-115420985 GCAGAAGGGACCCTGAGGTTTGG + Intergenic
961662626 3:128477736-128477758 TCACCAGGGGCCCTGAGGACTGG - Intergenic
966053709 3:175654839-175654861 TTACCAGGGAACCTGTGTATAGG + Intronic
972439024 4:39066985-39067007 TAACAGGGGAACCTGGGTATGGG - Intronic
985187616 4:187334413-187334435 TTACAAGGCACCCTCAGTTTTGG - Intergenic
986158813 5:5204519-5204541 TGACATGGAACCCTGTGTATTGG + Intronic
991980233 5:72222725-72222747 TCCCAAGGTACCCAGAGAATTGG - Intronic
995168644 5:109079311-109079333 TCACAAGGGACGATGTTTATTGG + Intronic
998062048 5:139126570-139126592 TCCCAGGGGCCCCTGAGAATGGG - Intronic
998928212 5:147151321-147151343 TGAAAAGGCAGCCTGAGTATTGG + Intergenic
1001952950 5:175829055-175829077 CCACAAAGGACCCTGGGAATAGG + Intronic
1002993036 6:2255586-2255608 TCACATGAGACCCTGAGCAGAGG - Intergenic
1003514686 6:6808105-6808127 GCAGGAGGGACCCTGAGAATGGG - Intergenic
1005029241 6:21493731-21493753 TCACATAGGTCCGTGAGTATAGG - Intergenic
1007004563 6:38348303-38348325 TCACAAGAAATCCTGAATATAGG + Intronic
1011258276 6:85446335-85446357 TAACAATGTAACCTGAGTATTGG + Intergenic
1016803904 6:148193591-148193613 TTACAAGGGAAGCTGAGTTTTGG + Intergenic
1018212433 6:161495459-161495481 TCACATGGGACCCTGAGTGCAGG - Intronic
1022320825 7:29286226-29286248 TCCCAAGGGAATCTGAGTAAGGG - Intronic
1024576148 7:50766204-50766226 TCACAAGGGACCCTGAGTATAGG - Intronic
1026892870 7:73992571-73992593 TCACAGGGGACCCTGGGTGAGGG + Intergenic
1028390591 7:90311917-90311939 TCACAGGGAACCCTAAGCATGGG + Intergenic
1030689203 7:112515509-112515531 GAACAAGGCAGCCTGAGTATGGG - Intergenic
1031160511 7:118161885-118161907 TCAGAAGGGACTCTAAGTAGCGG - Intergenic
1034520108 7:151613036-151613058 TCACCAGGGAGGCTGAGTGTGGG - Intronic
1035202415 7:157276101-157276123 TCCCAGGGGCCCCTGAGTAGGGG - Intergenic
1037165191 8:15818963-15818985 TCCCAAGGCACCAGGAGTATAGG - Intergenic
1040379041 8:46854548-46854570 TCACAAGGGTCCCTGTGTGCAGG - Intergenic
1045555167 8:103208570-103208592 TCACAAGGGGCCCTGCGCTTAGG + Intronic
1045667276 8:104502257-104502279 TCACAGGGGAGACCGAGTATAGG - Intronic
1045974089 8:108111517-108111539 TCATAAGGGAGTCTGTGTATAGG + Intergenic
1049440195 8:142606117-142606139 CCACAAGGGCACCTGAGTCTTGG - Intergenic
1051343515 9:16132131-16132153 TCACCAGGGACCCTGGAAATTGG - Intergenic
1055444395 9:76368323-76368345 TAACAAGTGACCCTCAGGATGGG + Intergenic
1055891430 9:81128386-81128408 TCTCTAGCTACCCTGAGTATTGG + Intergenic
1058337835 9:103854906-103854928 TCACAAGGGACAAAGAGAATAGG - Intergenic
1060920797 9:127418997-127419019 TCACATGGGACCCTGTGTTAGGG + Intergenic
1187461249 X:19489340-19489362 GCACATGGGACCCTGAGTGCAGG - Intronic
1192227150 X:69237191-69237213 GCACAGGGGCCCCTGAGTAGTGG - Intergenic
1198255573 X:134921485-134921507 TCATAAGGTAGCCTGAGTAGAGG + Intergenic
1199535714 X:148900592-148900614 TAACATTGGACCCTGAGGATGGG - Intronic