ID: 1024576864

View in Genome Browser
Species Human (GRCh38)
Location 7:50771497-50771519
Sequence CTGCTGGCTGTACTTTGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 111}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024576864_1024576869 -4 Left 1024576864 7:50771497-50771519 CCAGTTCAAAGTACAGCCAGCAG 0: 1
1: 0
2: 0
3: 16
4: 111
Right 1024576869 7:50771516-50771538 GCAGGACGGACTGCCCCCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 94
1024576864_1024576870 -3 Left 1024576864 7:50771497-50771519 CCAGTTCAAAGTACAGCCAGCAG 0: 1
1: 0
2: 0
3: 16
4: 111
Right 1024576870 7:50771517-50771539 CAGGACGGACTGCCCCCCTGGGG No data
1024576864_1024576868 -5 Left 1024576864 7:50771497-50771519 CCAGTTCAAAGTACAGCCAGCAG 0: 1
1: 0
2: 0
3: 16
4: 111
Right 1024576868 7:50771515-50771537 AGCAGGACGGACTGCCCCCCTGG 0: 1
1: 0
2: 0
3: 7
4: 125
1024576864_1024576877 17 Left 1024576864 7:50771497-50771519 CCAGTTCAAAGTACAGCCAGCAG 0: 1
1: 0
2: 0
3: 16
4: 111
Right 1024576877 7:50771537-50771559 GGGTTGCCAACACTCACAGGTGG No data
1024576864_1024576876 14 Left 1024576864 7:50771497-50771519 CCAGTTCAAAGTACAGCCAGCAG 0: 1
1: 0
2: 0
3: 16
4: 111
Right 1024576876 7:50771534-50771556 CTGGGGTTGCCAACACTCACAGG 0: 1
1: 0
2: 1
3: 8
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024576864 Original CRISPR CTGCTGGCTGTACTTTGAAC TGG (reversed) Intronic
902146533 1:14405772-14405794 GAGCTGGCTGGTCTTTGAACTGG - Intergenic
906370119 1:45246860-45246882 TTGCTGACTGTACAATGAACAGG + Intronic
907741921 1:57174724-57174746 ATGCTGGCTCTACTCCGAACAGG + Intronic
908559645 1:65292831-65292853 CTGCTGGCAGTAATTTAAATGGG + Intronic
908727552 1:67193076-67193098 CTCCTTGCTGCTCTTTGAACAGG + Intronic
908885795 1:68786827-68786849 CTGCTGGCTGGACTCTGCAATGG - Intergenic
909358568 1:74735788-74735810 CTGCTGTCTGCCCTTGGAACCGG - Intronic
911787979 1:101974695-101974717 CTGATGCCTGTGCTCTGAACCGG + Intronic
912606417 1:110994107-110994129 CTGCTGGCTCTACTTTGATTTGG - Intergenic
914926297 1:151891430-151891452 CTGCCATCTTTACTTTGAACTGG - Intronic
921078928 1:211723362-211723384 CAGCAGGCTGGACATTGAACTGG - Intergenic
1062804966 10:412131-412153 CTGCTGCTGGAACTTTGAACAGG - Intronic
1064995625 10:21294582-21294604 CTCCTGTCTGAACTTTGAAATGG - Intergenic
1068749882 10:60580354-60580376 ATGCTGGCTGTCATCTGAACAGG - Intronic
1076584281 10:131534805-131534827 CTGCCGGCTGTGCTTGGACCTGG - Intergenic
1084272818 11:68038285-68038307 CAGCTGCCTGCACTTTGGACAGG - Intergenic
1090900893 11:131030073-131030095 CTGCTGGTTGTTCTGTGAAGTGG + Intergenic
1101420885 12:104550022-104550044 CAGCTGGCTGTAAATTGCACCGG + Intronic
1103960164 12:124604322-124604344 CTGCTGTCTCCACTCTGAACTGG + Intergenic
1106248583 13:27967910-27967932 CTGCTCGCTGTACCTTGAATTGG + Intronic
1106776327 13:33013813-33013835 TTACTTGCTGTGCTTTGAACAGG - Intergenic
1107020700 13:35747866-35747888 CTGCTTGATTTACTTTGAACGGG - Intergenic
1108378649 13:49836728-49836750 CTGCTGGCTGGACTCTGGCCAGG + Intergenic
1111463247 13:88574408-88574430 CTTCTGACTGTAATTTGAACTGG + Intergenic
1112472288 13:99700058-99700080 TTGCTGGCTGCAATTTGAAATGG - Intronic
1113126343 13:106983532-106983554 CAGAGAGCTGTACTTTGAACTGG + Intergenic
1113693299 13:112327109-112327131 CTGCTGTCTGTACAGTGAACTGG - Intergenic
1114189079 14:20427548-20427570 CCGATGGGTGTATTTTGAACTGG - Intergenic
1117154344 14:52923175-52923197 CTCCTGACTGTATTTTTAACTGG + Intronic
1117444692 14:55792508-55792530 CTGTTGGCAGGAGTTTGAACTGG + Intergenic
1118965585 14:70581082-70581104 CTGCTGGCTGGAGTATAAACTGG + Intergenic
1121173097 14:91870647-91870669 CTGCAGCCTTTACTTTGTACAGG + Intronic
1121886742 14:97550041-97550063 CTGCTGGCTGGACTATAGACTGG - Intergenic
1121912073 14:97800680-97800702 CTGCTGGCAGGACTGTGAACTGG + Intergenic
1123102798 14:105817122-105817144 CAGCAGGCTGAACTTTGGACGGG + Intergenic
1125905307 15:43386276-43386298 CAGCTTGGTGGACTTTGAACAGG + Exonic
1131810548 15:96168842-96168864 CTGCTGGCTGTACTCTGCAGGGG - Intergenic
1132332083 15:101019488-101019510 CAGCTAGCTGTACTGTGAATGGG - Intronic
1134259621 16:12640557-12640579 GAGCTGGCTGTCCTTTGAAGGGG - Intergenic
1135956880 16:26963269-26963291 CTACTGGCTTAACTTTGAACAGG - Intergenic
1138585965 16:57970715-57970737 CTGCTGACTGCACTTTGATGAGG + Intronic
1141115802 16:81308159-81308181 CTGCTGGGTGTACAATGAGCTGG - Intergenic
1141920025 16:87129467-87129489 CTGCTGGCTGGAGCATGAACTGG - Intronic
1142692949 17:1617807-1617829 GTGCTGGGTGGACTTTGAAGGGG - Intronic
1143841638 17:9736705-9736727 CTGCTGGCTGCTGGTTGAACTGG - Intergenic
1150711613 17:67535180-67535202 CAGCTGGCTGGACACTGAACTGG - Intronic
1157140177 18:45097854-45097876 CTGCTGCCTTTACTTTCAATTGG - Intergenic
1157572859 18:48724421-48724443 CTTCTCGCTGTTCTTTGAACAGG + Intronic
1157726417 18:49967782-49967804 ATGCTGGCTGTACCTTGGAATGG + Intronic
1158132177 18:54164269-54164291 CTGGTGTCTGTCCTTTGGACAGG + Intronic
1159056399 18:63469130-63469152 CAGCTGGCTTTACTTGGAAAGGG - Intergenic
1163007679 19:14406700-14406722 CTGCTGGTTGGACTTTGAGCAGG + Exonic
1165354190 19:35293677-35293699 CTCCTGGCTGGCCTTTGAGCAGG - Intronic
1168131632 19:54324393-54324415 CTGATGGCTGTACTATCAGCAGG - Intergenic
1168593230 19:57653755-57653777 CTGTTGGCTGCACTTAAAACAGG - Intergenic
929587660 2:43126573-43126595 CTGCTGGCTGGATTTTAATCTGG + Intergenic
933374072 2:81456515-81456537 CTGCCAGCTGAAGTTTGAACAGG + Intergenic
933839511 2:86275251-86275273 CTGCAGGCAGGACTTTGAGCAGG + Intronic
934138931 2:89026331-89026353 CTTCTGGTTTTACTTTGCACCGG + Intergenic
934230316 2:90174229-90174251 CTTCTGGTTTTACTTTGCACCGG - Intergenic
935764848 2:106356401-106356423 GTGATTGCTGAACTTTGAACTGG + Intergenic
938236488 2:129710351-129710373 GTCCTGGCTGTACTCTGAGCCGG - Intergenic
939285034 2:140117863-140117885 GTACTGGCTGTTCTTTGAAGAGG - Intergenic
940209645 2:151243247-151243269 CTGATGGCTGTACTTTCTACAGG - Intergenic
942422541 2:175822696-175822718 CTGCTTGGAATACTTTGAACAGG + Intergenic
943635862 2:190306277-190306299 CTGCTGGGTGTGCTATGAATAGG + Intronic
1168906207 20:1405745-1405767 CTGCTGGCTCTACTATAATCAGG - Intergenic
1174160644 20:48547939-48547961 CTCCTGGCTGGTCTTTGAACTGG + Intergenic
1175974135 20:62701937-62701959 CAGCTTGCTGGACTGTGAACAGG - Intergenic
1175989295 20:62779504-62779526 AGGGTGTCTGTACTTTGAACTGG + Intergenic
1179064900 21:38015740-38015762 ATGCTGACTGTACTTGAAACTGG - Intronic
1183760070 22:39808138-39808160 GTGCTGGGTGTACTTTTAAATGG - Intronic
1184224650 22:43122371-43122393 CTCCTTCATGTACTTTGAACAGG - Intronic
1184365281 22:44047187-44047209 CTGCAGGCTGTACGTGGCACTGG + Intronic
1185167793 22:49272098-49272120 CAGCTGGGTGTCCTTGGAACTGG + Intergenic
954407467 3:50353448-50353470 CTGCTGGCTGTGCTGTGGGCAGG + Exonic
955714182 3:61811131-61811153 CTTCTGGCTGAACTTTGGGCTGG + Intronic
956376590 3:68619983-68620005 CTGCGTGCTGTACTTTGAAGGGG - Intergenic
959395174 3:105828128-105828150 CTGCTGGCTAGAATGTGAACAGG - Intronic
966534022 3:181010929-181010951 CTGCTGCCTGTCATGTGAACAGG - Intergenic
967085655 3:186092946-186092968 ATGCTGGCTGTATATAGAACTGG + Intronic
967233217 3:187360539-187360561 CTCCTGGCTGCTCTTTGCACAGG + Intergenic
972031772 4:34469155-34469177 GTGGTGGCTGTATTTTGAATAGG - Intergenic
976454401 4:85229096-85229118 AAGCTGGCTCTACTTTCAACTGG + Intergenic
979065321 4:116124437-116124459 CTTCTGCTTGTAATTTGAACAGG - Intergenic
979670290 4:123354293-123354315 CTGTTGGCTTTACTTTGCAAGGG + Intergenic
981173446 4:141651954-141651976 CTGCTGGGTGTACTTGCTACAGG - Intronic
982166460 4:152617901-152617923 CCGCTGGCTGCACAGTGAACAGG - Intergenic
982322766 4:154096873-154096895 CTGCTGGGTGAAATTTGACCAGG - Intergenic
982544231 4:156712594-156712616 CTTCTGCCTGGTCTTTGAACAGG + Intergenic
984483270 4:180333429-180333451 CTCCTTGCTGTTCCTTGAACAGG - Intergenic
984678787 4:182582165-182582187 ATGCTTGCTTTACTTTGAGCTGG - Intronic
984912585 4:184688261-184688283 CTGCTGGCAGGACTATAAACTGG - Intronic
988912598 5:35859508-35859530 CTGGTGGCAGAACTGTGAACTGG + Intronic
990209183 5:53463908-53463930 CTGTTGGTTGTCCTTTGAACAGG - Intergenic
993137372 5:83986708-83986730 CTGCTGGCTGTCCCTTCTACAGG - Intronic
1002650541 5:180689537-180689559 CAGCGAGCTGTACTTTGAAGTGG + Intergenic
1003128117 6:3372380-3372402 CTGCTGGCTGTGCTGGGAAGGGG + Intronic
1005385753 6:25282432-25282454 CTCCTTGCTGTTCCTTGAACAGG + Intronic
1010176356 6:73032686-73032708 TGGCTTGCTGTACCTTGAACTGG - Intronic
1012157651 6:95840159-95840181 CTGCTCCCTGTGCTTTGATCGGG + Intergenic
1015149417 6:130020480-130020502 CTGCGGGCTGTGCTTTGACCGGG - Intronic
1022538041 7:31110182-31110204 TTGCTGGCTTCACTTTGAAGTGG - Exonic
1024576864 7:50771497-50771519 CTGCTGGCTGTACTTTGAACTGG - Intronic
1026642510 7:72139778-72139800 CTGATGGCTGTATTTGGAGCAGG + Intronic
1026730939 7:72911282-72911304 CTGCTTCATGTATTTTGAACAGG + Intronic
1027113145 7:75456844-75456866 CTGCTTCATGTATTTTGAACAGG - Intronic
1027285395 7:76641455-76641477 CTGCTTCATGTATTTTGAACAGG - Intergenic
1037872180 8:22508835-22508857 ATGCTGGATCTACTTTGAAATGG + Intronic
1040033861 8:42850143-42850165 CTCCTTGCTGTCCTTTGAGCAGG - Intronic
1040434876 8:47380496-47380518 CTGCTTGGTGAACTTTGACCCGG + Intronic
1046239970 8:111477422-111477444 GTGCTGGCTGTTTCTTGAACAGG - Intergenic
1047707775 8:127517878-127517900 CTGCTGGCTGTACATGAAACAGG - Intergenic
1049188512 8:141272498-141272520 CCGCTGTCAGTACTGTGAACAGG + Intronic
1049856546 8:144865513-144865535 CTGTTGGCTGCACTTAAAACAGG + Intergenic
1052047399 9:23810601-23810623 CTGCTGGCTGTAGTTTAAGGTGG - Intronic
1055421022 9:76142467-76142489 CTCCTTGCTTTTCTTTGAACAGG - Intronic
1056059115 9:82864331-82864353 CTGCTGGCAGTACGTTAATCTGG + Intergenic
1056952693 9:91056825-91056847 CTGCTGGCTGTACATTTATTTGG + Intergenic
1058635545 9:107034884-107034906 CTGGTGGCTCTGCTTTGAAAAGG - Intergenic
1059396743 9:114039205-114039227 CTCCTGGCTGTACTTTAACGCGG - Intronic
1060647873 9:125297561-125297583 CTTCTTGCTGTTCCTTGAACAGG - Intronic
1062434005 9:136538377-136538399 CCGCTGGCTGTAGTTGGAAGGGG + Intronic
1194142317 X:90221377-90221399 CTGTTGGCTGCACTTCAAACAGG + Intergenic
1195878948 X:109572776-109572798 CGGCCGCCTGAACTTTGAACTGG + Intergenic
1196964259 X:121038609-121038631 CTGCTGGCTGGTCCTTCAACTGG + Intergenic
1199828350 X:151523190-151523212 CTCCTGGCTTTACATTGAATAGG - Intergenic
1200488070 Y:3790478-3790500 CTGTTGGCTGCACTTCAAACAGG + Intergenic