ID: 1024577354

View in Genome Browser
Species Human (GRCh38)
Location 7:50775421-50775443
Sequence CAGCTCTCACAGGTTGCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 234}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024577345_1024577354 20 Left 1024577345 7:50775378-50775400 CCTGGGCAGCCCTGCAGCCAACT 0: 1
1: 0
2: 2
3: 27
4: 264
Right 1024577354 7:50775421-50775443 CAGCTCTCACAGGTTGCAGTTGG 0: 1
1: 0
2: 3
3: 20
4: 234
1024577350_1024577354 3 Left 1024577350 7:50775395-50775417 CCAACTGCTGGGCACAGCCCTCA 0: 1
1: 0
2: 2
3: 31
4: 295
Right 1024577354 7:50775421-50775443 CAGCTCTCACAGGTTGCAGTTGG 0: 1
1: 0
2: 3
3: 20
4: 234
1024577344_1024577354 27 Left 1024577344 7:50775371-50775393 CCAAGGACCTGGGCAGCCCTGCA 0: 1
1: 0
2: 13
3: 123
4: 664
Right 1024577354 7:50775421-50775443 CAGCTCTCACAGGTTGCAGTTGG 0: 1
1: 0
2: 3
3: 20
4: 234
1024577343_1024577354 28 Left 1024577343 7:50775370-50775392 CCCAAGGACCTGGGCAGCCCTGC 0: 1
1: 3
2: 26
3: 274
4: 1183
Right 1024577354 7:50775421-50775443 CAGCTCTCACAGGTTGCAGTTGG 0: 1
1: 0
2: 3
3: 20
4: 234
1024577349_1024577354 10 Left 1024577349 7:50775388-50775410 CCTGCAGCCAACTGCTGGGCACA 0: 1
1: 0
2: 1
3: 24
4: 232
Right 1024577354 7:50775421-50775443 CAGCTCTCACAGGTTGCAGTTGG 0: 1
1: 0
2: 3
3: 20
4: 234
1024577348_1024577354 11 Left 1024577348 7:50775387-50775409 CCCTGCAGCCAACTGCTGGGCAC 0: 1
1: 0
2: 2
3: 21
4: 216
Right 1024577354 7:50775421-50775443 CAGCTCTCACAGGTTGCAGTTGG 0: 1
1: 0
2: 3
3: 20
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024577354 Original CRISPR CAGCTCTCACAGGTTGCAGT TGG Intronic
900789723 1:4671903-4671925 CTGCTCTCAGGCGTTGCAGTAGG + Intronic
905003915 1:34695212-34695234 CCTCTCTCACTGGTTGCAGATGG + Intergenic
905049992 1:35042129-35042151 CAGGAGTCAGAGGTTGCAGTGGG + Intergenic
905180573 1:36163089-36163111 CAGCTCTCAGAGGGTGGAGATGG + Intronic
905496217 1:38390000-38390022 ATGCTCTCACAGGTTGGAGTTGG + Intergenic
906419599 1:45653770-45653792 CAGGTGGCAGAGGTTGCAGTGGG - Intronic
909984184 1:82140436-82140458 CACCTCTCTCAGGATGCAATGGG - Intergenic
911156433 1:94641983-94642005 CAGCTCTCCCAGGTGACAGGAGG + Intergenic
912453184 1:109779986-109780008 CATCTCTCACAGGTTGTAGTTGG + Intergenic
912894020 1:113566120-113566142 CAGCTCTCATATATTGCAGGTGG + Intronic
919238787 1:194883414-194883436 CAGCAGACAGAGGTTGCAGTGGG + Intergenic
919840093 1:201602725-201602747 CAGCTCTCAAGGGGTGCAGAAGG - Intergenic
920282039 1:204851198-204851220 CTGCTCTCACATGCTGAAGTTGG - Intronic
921520638 1:216151179-216151201 CAGCTGTCAGAGGTTGTAATGGG - Intronic
922638365 1:227200355-227200377 CAGGAGGCACAGGTTGCAGTGGG + Intronic
923021786 1:230170177-230170199 GAGCTTTCAAAGCTTGCAGTAGG + Intronic
923075801 1:230607635-230607657 CAGCTGTCAGAGGTTGTAATGGG - Intergenic
923137479 1:231131184-231131206 CGGGTGTCAGAGGTTGCAGTGGG - Intergenic
1062875672 10:941159-941181 CAGCACCCACAGGTGGGAGTGGG - Intergenic
1064016124 10:11773693-11773715 CAGCTCACACAGGTAGTTGTCGG - Intergenic
1065610849 10:27469469-27469491 CAGCTGTCAGAGGTTGTAATGGG - Intergenic
1066131224 10:32395916-32395938 CAGGAGTCAGAGGTTGCAGTGGG + Intergenic
1066754808 10:38700537-38700559 CTACTCTCACTGGTTGGAGTTGG + Intergenic
1069059106 10:63875050-63875072 CAGATCTCAGTGGTTGCAGTGGG - Intergenic
1069212667 10:65780416-65780438 AAGCTCTCCCAGAATGCAGTGGG - Intergenic
1074202887 10:111255590-111255612 TAGCTTTCACAGGCTTCAGTAGG + Intergenic
1074574822 10:114658660-114658682 CAGATCTCACAGGTGGAGGTGGG + Intronic
1074957639 10:118407941-118407963 CACCTCTCACTGGCTGCAGTGGG - Intergenic
1075093133 10:119454471-119454493 CAGCACTCACGGGATGCAGAGGG + Intronic
1075438554 10:122462026-122462048 CAGCTGGCACAGGTTGGCGTAGG - Exonic
1075923771 10:126234832-126234854 CAGCCATCACTGGTAGCAGTTGG - Intronic
1076207413 10:128614213-128614235 CAGCTCTCCAAGGCTGGAGTTGG - Intergenic
1077079301 11:717280-717302 CAGATCCAACAGGTTACAGTGGG - Intronic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1078358668 11:10651902-10651924 CAGCTCATGTAGGTTGCAGTGGG - Intronic
1079006387 11:16794251-16794273 CAACTCTCCCATTTTGCAGTTGG - Intronic
1082265975 11:50118927-50118949 CAGCTGCCAAAGGATGCAGTAGG + Intergenic
1082290113 11:50359645-50359667 CAGCTGCCAAAGGATGCAGTAGG - Intergenic
1083802551 11:65054726-65054748 CAGCGTTCACAGCCTGCAGTGGG + Exonic
1084354866 11:68631363-68631385 CAGCTGTCAGAGGTTGTAATGGG - Intergenic
1084803639 11:71564263-71564285 CTGCTCTCATGGGTTGGAGTTGG - Intronic
1085100709 11:73797536-73797558 CAGCTTTCACAGCTGGCACTGGG - Intronic
1085739254 11:79064982-79065004 CAGCTCCCGCAGGGTGAAGTTGG + Exonic
1086419594 11:86625526-86625548 CAGCTCTTACAGGTAACTGTTGG + Intronic
1094826426 12:34272728-34272750 CAGCTGTCAGAGGTTGTAATGGG - Intergenic
1096547411 12:52350177-52350199 CAGCTCAGCCAGCTTGCAGTGGG - Intergenic
1098360239 12:69647393-69647415 CACCACTCACAGGTAGCAGAAGG + Intronic
1103369466 12:120407965-120407987 CAGCAGACAGAGGTTGCAGTAGG - Intergenic
1103510466 12:121470021-121470043 CAGCAGGCAGAGGTTGCAGTGGG + Intronic
1104320208 12:127743560-127743582 CACATCTCACTGGCTGCAGTTGG - Intergenic
1104749072 12:131227086-131227108 CGGCTCCCACAGGCTGCTGTGGG - Intergenic
1105441849 13:20421686-20421708 CAGCTCCCTCAGTTTGAAGTTGG - Intronic
1109525331 13:63567132-63567154 CAGCTCCCACAGATGGCACTGGG - Intergenic
1109602524 13:64650578-64650600 CAGCTCTCTCAAGTTGGAGTCGG - Intergenic
1109837580 13:67878650-67878672 TTGCTCTGACAGGTTGCACTTGG - Intergenic
1112051703 13:95649497-95649519 CAGCTGTCACAGGTTGGTGTTGG + Intergenic
1112367324 13:98766447-98766469 CAGCTCTTACAGGCTGCAGAGGG + Intergenic
1112434344 13:99380955-99380977 CTGCTGTCACAGCTTGCAGCGGG - Intronic
1113582003 13:111436585-111436607 AAGATCTCACAGGTTGCAAGCGG - Intergenic
1114349168 14:21831324-21831346 CAGCTTTCACAGAATGGAGTTGG + Intergenic
1114753660 14:25234324-25234346 CAGGTGGCAGAGGTTGCAGTGGG - Intergenic
1116833398 14:49744999-49745021 CAACTCTCACAGGTAGAAATAGG - Intronic
1118007651 14:61578567-61578589 CAGCTCTCGCAGGTTGTGATAGG + Intronic
1118936641 14:70294891-70294913 CAGCTGTCAGAGGTTGTAATGGG + Intergenic
1119020559 14:71108614-71108636 CAGCTCTCACTCTGTGCAGTCGG + Exonic
1119248011 14:73129652-73129674 CAGCTGTCAGAGGTTGTAATGGG + Intergenic
1119661661 14:76456580-76456602 CATTTCTGACAGGTTGCAGGTGG + Intronic
1120870891 14:89336572-89336594 CAGGTCACACAGCTTGCAGATGG - Intronic
1121874571 14:97439807-97439829 GAGCTCTCACAGATCACAGTGGG + Intergenic
1122033035 14:98927439-98927461 CAGGAGTCAGAGGTTGCAGTGGG + Intergenic
1122041571 14:98991432-98991454 CAGCTGTCAGAGGTTGTAATGGG - Intergenic
1202904071 14_GL000194v1_random:58640-58662 CCGCTCTGACTGGTTGCAGTTGG + Intergenic
1124444278 15:29715327-29715349 CAGCACTCTCAGTTTGCATTTGG + Intronic
1125759706 15:42088261-42088283 CAGCCATCACAGGGAGCAGTGGG + Intronic
1125930155 15:43594314-43594336 CAGCTCGTACAGGTTCCGGTCGG - Exonic
1125943323 15:43694146-43694168 CAGCTCGTACAGGTTCCGGTCGG - Exonic
1127016566 15:54695304-54695326 AAGCTCTCACTGTTTGCAGAGGG + Intergenic
1129231672 15:74200507-74200529 CAGCACTCTCAGGCTGGAGTTGG - Intronic
1129826033 15:78635635-78635657 CTGCTGCCACAGGCTGCAGTGGG - Intronic
1130028455 15:80290293-80290315 CAGCTCTCACAGCTTTCCTTGGG - Intergenic
1130558807 15:84943110-84943132 CAGGAGGCACAGGTTGCAGTGGG + Intronic
1131089535 15:89612350-89612372 CAGCTCTCTTAGGCTACAGTGGG - Intronic
1132103862 15:99048764-99048786 CAGGTGGCAGAGGTTGCAGTGGG + Intergenic
1133116710 16:3581707-3581729 CAGCTGTCCCAGGGGGCAGTGGG - Exonic
1133766154 16:8839403-8839425 CAGCTGTCAGAGGTTGTAATGGG + Intronic
1136727880 16:32376301-32376323 CTACTCTCACTGGTTGGAGTTGG - Intergenic
1138758432 16:59516425-59516447 CAGCTGTCAGAGGTTGTAATGGG + Intergenic
1139171535 16:64635891-64635913 CAGCTCTGGCATTTTGCAGTAGG + Intergenic
1139893698 16:70271099-70271121 CAGCAGGCAAAGGTTGCAGTGGG + Intronic
1140980266 16:80102060-80102082 GAGCTCACACATTTTGCAGTGGG + Intergenic
1202998555 16_KI270728v1_random:141453-141475 CTACTCTCACTGGTTGGAGTTGG + Intergenic
1203130152 16_KI270728v1_random:1677857-1677879 CTACTCTCACTGGTTGGAGTTGG + Intergenic
1144092285 17:11868866-11868888 CAGCTCTCTCATCTTGGAGTAGG + Intronic
1147163755 17:38582453-38582475 CAAATCTCACAGTTGGCAGTGGG + Intronic
1147212194 17:38878168-38878190 CAGGACTCACGCGTTGCAGTAGG - Exonic
1152261443 17:79269469-79269491 CAGCTCTCAGAGGCAGGAGTGGG - Intronic
1154387381 18:13906643-13906665 CAGCTCTCACAGTTTTCTGGTGG - Intronic
1156237820 18:35221091-35221113 CAGCTGTCAGAGGTTGTAATGGG - Intergenic
1156507783 18:37609433-37609455 CAGGCCTCACAGGCTGCAGCTGG + Intergenic
1158641506 18:59207670-59207692 AAGCTCACACAGTTTGCAGCCGG + Intergenic
1159623938 18:70670141-70670163 CAGCTTCCACAGGTGGCACTGGG - Intergenic
1160345219 18:78127156-78127178 CAGCCCTCAGAGGCTCCAGTGGG + Intergenic
1162331059 19:10030141-10030163 CAGCTGTTAAAGGTTGTAGTGGG + Intergenic
1163899493 19:20089145-20089167 CAGCTGTCAGAGGTTGTAATGGG + Intronic
1164439719 19:28264678-28264700 CAGCTCTCACAGGCGTCAGTGGG + Intergenic
1164557339 19:29263669-29263691 GAGCTCTCCCAGGCTGCAGCGGG - Intergenic
924970603 2:123887-123909 CAGGTCTCACAAGTTGCAATTGG - Intergenic
929786247 2:44994723-44994745 CAGCTATCCCAGGTTGCGGGAGG + Intergenic
930469379 2:51793535-51793557 CTGCTCTCACAGGTTGTAGTTGG + Intergenic
931639946 2:64373129-64373151 CAGCAGGCAGAGGTTGCAGTGGG + Intergenic
932060768 2:68495532-68495554 CTGCTCTCACAGGCTGGAGTTGG + Intronic
934071142 2:88384821-88384843 CATTTCCCACAGGTTTCAGTTGG - Intergenic
934318095 2:91944772-91944794 CTACTCTCACTGGTTGGAGTTGG + Intergenic
935278045 2:101492637-101492659 CAGCTCTCAGCAGTTGGAGTTGG - Intergenic
935862071 2:107342581-107342603 GAGCTCACACAGGTGGCTGTTGG + Intergenic
935870141 2:107439247-107439269 CAGCTCTCCCAGGCTGGTGTTGG - Intergenic
936603596 2:113924968-113924990 CAGGAGTCAGAGGTTGCAGTAGG - Intronic
937481152 2:122260823-122260845 CTGCTCTCCCAGGTTCCACTTGG - Intergenic
939806112 2:146777421-146777443 CAGCTCTAACAGCTTGCATTTGG - Intergenic
940264852 2:151826046-151826068 CAGGAGGCACAGGTTGCAGTGGG + Intronic
940530701 2:154873104-154873126 CAGCTGTCAAAGGTTGTAATGGG - Intergenic
941297676 2:163760433-163760455 CAGCTTTCAGAGGTTGCAGAAGG + Intergenic
941455490 2:165709038-165709060 CAGCTGTCAGAGGTTGTAATGGG + Intergenic
942738629 2:179146856-179146878 CAGCTATCAAAGATTGCTGTAGG - Intronic
942839421 2:180341221-180341243 AAGTTCACACAGTTTGCAGTGGG + Intergenic
943412289 2:187559396-187559418 CAGCTGTCAGAGGTTGTAATGGG + Intronic
944456042 2:199895737-199895759 CAGCTCTCTCTCATTGCAGTAGG - Intergenic
946128596 2:217586487-217586509 CAGCTCTCACAGGATGCCCATGG + Intronic
946658514 2:221975183-221975205 CATATCTCACATCTTGCAGTGGG - Intergenic
947360660 2:229342257-229342279 CAGTTCTCTGAGGATGCAGTTGG + Intergenic
948834213 2:240616969-240616991 CAGCTCCCCCAGGTGGCTGTTGG - Intronic
948834228 2:240617083-240617105 CAGCTCCCCCAGGTGGCTGTTGG - Intronic
948834245 2:240617197-240617219 CAGCTCCCCCAGGTGGCTGTTGG - Intronic
949078794 2:242080128-242080150 CAGCTCTCATAGTTTACAATAGG + Intergenic
1169198157 20:3694347-3694369 CAGCTCTCCCAGGCTGCATGTGG - Exonic
1170367179 20:15610621-15610643 CAGCAGTCACAGGTTCCAGGTGG + Intronic
1171214422 20:23341888-23341910 CAGCTTTCCCAGGCTGCAGGGGG + Intergenic
1173417429 20:42869305-42869327 CAGCTCTCAGTGGTTGGGGTTGG - Intronic
1173677737 20:44852312-44852334 CAGGACACAGAGGTTGCAGTGGG + Intergenic
1175303038 20:57956540-57956562 CAGCTCTCAGGGGTCGCAGGAGG - Intergenic
1175615417 20:60394079-60394101 CAGTTCACACAGGGAGCAGTAGG + Intergenic
1176214872 20:63943224-63943246 CAGCTTTCCCTGGTTGCAGGTGG - Intronic
1176623441 21:9073407-9073429 CCGCTCTGACTGGTTGCAGTCGG + Intergenic
1176943043 21:14947001-14947023 GTGCTCTGACAGGGTGCAGTAGG - Intergenic
1177960546 21:27660848-27660870 CAGCTCTGACTGGTAGGAGTTGG - Intergenic
1178693987 21:34777128-34777150 CAACTCTCACACTTTGCAGGTGG - Intergenic
1179309205 21:40181955-40181977 CACCTCACAGAGGCTGCAGTGGG - Intronic
1180181193 21:46119360-46119382 CAGCCCTCACAGGATGCCCTGGG - Intronic
1180306266 22:11128457-11128479 CTACTCTCACTGGTTGGAGTTGG + Intergenic
1180544785 22:16490640-16490662 CTACTCTCACTGGTTGGAGTTGG + Intergenic
1183024872 22:35057570-35057592 CAGCTTTCACAGCTGGCACTGGG + Intergenic
1183222164 22:36522278-36522300 CAGCAGGCAGAGGTTGCAGTTGG + Intronic
1183240822 22:36657082-36657104 CAGCTCTCTCAGGTAGTGGTTGG + Intronic
949171215 3:999477-999499 CAGCTCTCACACATTGCTGAGGG - Intergenic
949373967 3:3366465-3366487 CAGCTCTCCCAGGCTACACTTGG + Intergenic
949967308 3:9368434-9368456 CAGGTGGCAGAGGTTGCAGTAGG - Intronic
950626966 3:14254366-14254388 CAGCCCTCCCAGGCTGCAGAAGG + Intergenic
951687578 3:25362224-25362246 CAGCTCTACCAAGCTGCAGTCGG + Intronic
951762118 3:26159077-26159099 CAGCTGTCAGAGGTTGTAATGGG + Intergenic
952858148 3:37790317-37790339 CTGCTCTCACAGGAGGCTGTTGG + Intronic
954199475 3:49015650-49015672 CAGCTCTCAGAAGCTGCAGGCGG + Exonic
955138057 3:56239430-56239452 CAGGTGGCAGAGGTTGCAGTGGG + Intronic
956520495 3:70098335-70098357 GAGCTCACTCAGGTGGCAGTAGG - Intergenic
956727155 3:72165339-72165361 CTCTTCTCCCAGGTTGCAGTAGG + Intergenic
960054212 3:113265072-113265094 CAGCTGTCAGAGGGTGCAGCAGG + Intronic
960884157 3:122377105-122377127 CAGCACGCAGAGGTTGCAGTGGG + Intronic
961391774 3:126556356-126556378 CAGCCCCCACAGGCTGCTGTGGG - Intronic
961829703 3:129617166-129617188 CAGCTCTCACAGGCTGGGTTAGG + Intergenic
961852288 3:129832940-129832962 CATCTCTCACTGGTAGAAGTAGG + Intronic
962805665 3:138925302-138925324 CAGGACGCAGAGGTTGCAGTGGG + Intergenic
962883556 3:139601681-139601703 CTGCTCTCACAGGATGGGGTTGG + Intronic
963059081 3:141210289-141210311 CAGCTGTCAGAGGTTGTAATGGG - Intergenic
963511821 3:146256628-146256650 CTACTCTCATAGGTTGGAGTTGG + Intergenic
965045691 3:163573800-163573822 GAGCTCTCCCTGGTTGCAGCTGG - Intergenic
965256743 3:166423946-166423968 CGGCTCTCTCAGCTTGCAGCGGG + Intergenic
966067507 3:175834741-175834763 CAGCTGTCAGAGGTTGTAATGGG - Intergenic
967313302 3:188126988-188127010 CAGCTCTAAAAGGAAGCAGTTGG - Intergenic
968866694 4:3217475-3217497 CAGCTGTCACAGGCTGCTGCTGG + Intronic
969017069 4:4110405-4110427 CAGGAGTCAGAGGTTGCAGTGGG + Intergenic
971117437 4:23664528-23664550 CAGTGCTCACAGCTTGCAGCAGG - Intergenic
971520651 4:27546543-27546565 CAGCTCTCCTAGGCTGAAGTTGG + Intergenic
977230037 4:94440904-94440926 CAGCTTCCACAGGCTGCAGTTGG - Intergenic
977285104 4:95094603-95094625 CAGTACTCACTGGTTGCAGTGGG - Intronic
977950580 4:102966059-102966081 CTGCTCTCACTGGTTGGAATTGG + Intronic
978512746 4:109539033-109539055 CAGGACGCAGAGGTTGCAGTGGG - Intronic
978609487 4:110521950-110521972 CAGGAGGCACAGGTTGCAGTGGG - Intronic
981282211 4:142971347-142971369 CAGTTCTCACAGGATGATGTAGG + Intergenic
982073849 4:151719380-151719402 CAGCTCTGAGAACTTGCAGTGGG + Intronic
982795273 4:159636860-159636882 CAGCAGGCAGAGGTTGCAGTGGG - Intergenic
982849764 4:160297593-160297615 CAACCCTCAGAGGTGGCAGTAGG - Intergenic
985212300 4:187608177-187608199 CTGCTCTAACACCTTGCAGTGGG + Intergenic
987618734 5:20310838-20310860 CAGCAATGACAGATTGCAGTTGG - Intronic
989307617 5:39975625-39975647 CAGCTCTTACAGCTTCCATTTGG + Intergenic
991006358 5:61832125-61832147 CATCACTCACAGGATGCAGAAGG - Intergenic
991359171 5:65802383-65802405 CAGCTTTCACAGCTGGCACTGGG + Intronic
993768379 5:91892325-91892347 CAGCTCTCAAAGGTGGCACATGG + Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
994592648 5:101791569-101791591 CAGCTCTCTCAGGTTGGAATTGG + Intergenic
998283734 5:140837748-140837770 CAGGACTTTCAGGTTGCAGTGGG - Intronic
998546071 5:143028998-143029020 CAGCTCTCAGAAGCTTCAGTGGG - Intronic
1000266370 5:159641715-159641737 CAGCTCCCACAGCTGGCACTGGG - Intergenic
1001597950 5:172910156-172910178 CTGATCTCACAGGATGCTGTGGG + Intronic
1002451005 5:179318476-179318498 CAGCTGTCCCACTTTGCAGTGGG - Intronic
1002932615 6:1644782-1644804 AAGCTGTCAGAGCTTGCAGTGGG - Intronic
1003021604 6:2514607-2514629 CAGCCCTCACTCGTTTCAGTGGG + Intergenic
1005572742 6:27161327-27161349 TAGCCCTCACAGGATGCTGTGGG - Intergenic
1009343875 6:62590298-62590320 CAGCTGTCAGAGGTTGTAATGGG - Intergenic
1010586038 6:77659465-77659487 CAGCTGTCAGAGGTTGTAATGGG + Intergenic
1011723437 6:90183568-90183590 CTGCTTTCACTGGTGGCAGTAGG - Intronic
1012620095 6:101333446-101333468 CAGGTCTCACAGGGGCCAGTGGG + Intergenic
1013850220 6:114504878-114504900 TAGCTCTCACTGGTGGAAGTTGG + Intergenic
1014445172 6:121518384-121518406 CAGCTCTTGCAGGCTGAAGTGGG + Intergenic
1016205125 6:141459257-141459279 CAGCTGTCAGAGGTTGTAATGGG - Intergenic
1017695306 6:157008821-157008843 GAGCTCTCACAGTTTGTAATGGG + Intronic
1019770801 7:2882729-2882751 GAGCTCTGCCAGGTTGCAGGGGG + Intergenic
1022816724 7:33921404-33921426 CAACTCTCGCTGATTGCAGTAGG - Intronic
1023766724 7:43518420-43518442 CAGGTAGCAAAGGTTGCAGTGGG + Intronic
1024196222 7:47061600-47061622 CAACTCTCATTGGTTGCAGCTGG - Intergenic
1024577354 7:50775421-50775443 CAGCTCTCACAGGTTGCAGTTGG + Intronic
1024941962 7:54772803-54772825 GAGCTCTCACTGATTGCCGTGGG + Intergenic
1026345665 7:69472010-69472032 CAGCTTTCTCAGATTTCAGTAGG - Intergenic
1027164992 7:75828021-75828043 CAGCTCTCCCAGGTCGGCGTGGG + Intergenic
1028597032 7:92556653-92556675 AAGCTATCACAGGTTGGAGGAGG - Intergenic
1030040825 7:105448414-105448436 CAGCTCTCAGAGGGTGCAGGTGG + Intronic
1030258685 7:107540502-107540524 CAGCACTTAGAGGTTACAGTGGG + Intronic
1035537058 8:400148-400170 CAGCTCTCATAGTTTACAATAGG + Intergenic
1037346091 8:17902923-17902945 GGGCTCTCAGAGGTTTCAGTAGG - Intronic
1039083853 8:33760343-33760365 CAGCTCCCAGGGGTTGGAGTTGG + Intergenic
1039841954 8:41300221-41300243 CAGCTTTCACAGTTAGCATTAGG - Intronic
1040707049 8:50141294-50141316 AAGCTCTTACAGGTTGCTGGTGG - Intronic
1044363884 8:91320566-91320588 CATCATGCACAGGTTGCAGTGGG + Intronic
1044441598 8:92230759-92230781 CAGCTCCCTCAGCTTGCAGGGGG + Intergenic
1044617647 8:94158575-94158597 CAGTTTTCAGAGCTTGCAGTGGG - Intronic
1045396573 8:101766648-101766670 CAGGATTCAGAGGTTGCAGTGGG - Intronic
1049541092 8:143209344-143209366 CAGCACTCAGAGGTAGCTGTGGG - Intergenic
1049783855 8:144441169-144441191 CAGGGCTCACAGCTTGCAGGTGG - Intronic
1053354206 9:37432602-37432624 CAGGAGGCACAGGTTGCAGTAGG + Intronic
1056255982 9:84800274-84800296 CAGGAGGCACAGGTTGCAGTGGG - Intronic
1056324544 9:85465463-85465485 CAGCTGTCAGAGGTTGTAATGGG - Intergenic
1057851240 9:98568423-98568445 CAGCTCTCACAGGCTGGACGTGG + Intronic
1058107619 9:100990711-100990733 CAACTCTCAGAGATTGCAGAGGG - Intergenic
1059063291 9:111055863-111055885 AAGCTCTCCTAGGATGCAGTGGG - Intergenic
1060226610 9:121795289-121795311 CAGCTGTCAGAGGTTGTAATGGG - Intergenic
1062731631 9:138113346-138113368 CGTCTCTCACAAGTTGGAGTTGG - Intronic
1203746625 Un_GL000218v1:43835-43857 CCGCTCTGACTGGTTGCAGTCGG + Intergenic
1203563482 Un_KI270744v1:75645-75667 CTGCTCTGACTGGTTGCAGTTGG - Intergenic
1189112403 X:38305339-38305361 CAGGTGGCAGAGGTTGCAGTGGG + Intronic
1190537338 X:51442151-51442173 CAGCTCTCACAGGTTAGAGTAGG - Intergenic
1190775957 X:53552415-53552437 GAGCTCTCAGAGGATGCAGGTGG + Exonic
1192200007 X:69060730-69060752 CAGCTCTCCCAGGAGGGAGTGGG - Intergenic
1192873246 X:75204879-75204901 CAGCTCTCAGAGGTTGTGGGTGG + Intergenic
1193541387 X:82776184-82776206 CAGCTCTCCTTGGGTGCAGTTGG + Intergenic
1193949350 X:87778817-87778839 CAGCTTTGCCAGGCTGCAGTGGG - Intergenic
1196111582 X:111952345-111952367 CAGCCCTCACAATTTGCAGGGGG + Exonic
1196525070 X:116721718-116721740 CAGCTGTCAGAGGTTGTAATGGG + Intergenic
1197509883 X:127358015-127358037 CAGGAGTCAGAGGTTGCAGTGGG - Intergenic
1199929478 X:152503945-152503967 CTACTCTTACAGGTTGGAGTTGG + Intergenic
1201159952 Y:11158849-11158871 CCGCTCCGACTGGTTGCAGTCGG + Intergenic