ID: 1024577813

View in Genome Browser
Species Human (GRCh38)
Location 7:50779174-50779196
Sequence GACACTAAAGTGAACACAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 190}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024577808_1024577813 17 Left 1024577808 7:50779134-50779156 CCAGGTAAAGTGTCCTCTTCAGA 0: 1
1: 0
2: 0
3: 15
4: 175
Right 1024577813 7:50779174-50779196 GACACTAAAGTGAACACAGGGGG 0: 1
1: 0
2: 0
3: 10
4: 190
1024577809_1024577813 4 Left 1024577809 7:50779147-50779169 CCTCTTCAGAGAATTTCTAGAGA 0: 1
1: 0
2: 3
3: 28
4: 193
Right 1024577813 7:50779174-50779196 GACACTAAAGTGAACACAGGGGG 0: 1
1: 0
2: 0
3: 10
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024577813 Original CRISPR GACACTAAAGTGAACACAGG GGG Intronic
901011441 1:6204936-6204958 GACACTCAGGAGAACACGGGCGG + Intronic
903774252 1:25782692-25782714 GACACTAAAGTGAGCAGTGTGGG + Exonic
905197250 1:36289893-36289915 TACTCTCCAGTGAACACAGGTGG - Intronic
907345321 1:53773473-53773495 GAGACTAAAGGGAGCAAAGGGGG - Intronic
907654012 1:56323709-56323731 GATACTACAGTGAACAAATGAGG + Intergenic
908851677 1:68383041-68383063 GACACTAAGGTTAGCACTGGGGG + Intergenic
909196762 1:72636501-72636523 GAAAGTAAAGAGAACAAAGGAGG - Intergenic
910261287 1:85296011-85296033 GTCTGTACAGTGAACACAGGTGG + Intergenic
910558472 1:88563958-88563980 CACACTAAAATGAGCACATGAGG - Intergenic
913468374 1:119166280-119166302 GATACTAAAGAAAAGACAGGAGG + Intergenic
914256854 1:145967262-145967284 GAGACTCACTTGAACACAGGAGG - Intronic
914974876 1:152352111-152352133 GACAGTGAAGTGCACTCAGGGGG - Exonic
914974985 1:152353023-152353045 GACAGTGAAGTGCACTCAGGGGG - Exonic
914975008 1:152353248-152353270 GACAGTGAAGTGCACTCAGGGGG - Exonic
914975040 1:152353479-152353501 GACAGTGAAGTGCACTCAGGGGG - Exonic
916957526 1:169854682-169854704 GATACTAAAGTAAACCCAGGAGG - Exonic
917307271 1:173639467-173639489 GAAGCTAAAGAGAACACAGAAGG + Intronic
919471655 1:197986803-197986825 GAGAGAAAAGTGAACATAGGTGG + Intergenic
920388888 1:205586554-205586576 GGCACCAAGGTAAACACAGGAGG - Intronic
922516493 1:226212035-226212057 GGAACTAAAGTGAAGACAGTCGG + Intergenic
1068535605 10:58238010-58238032 GACACTAAAATGAAGACATTTGG - Intronic
1070107750 10:73451833-73451855 GAGAATACAGTGAACCCAGGAGG - Intronic
1070128622 10:73641353-73641375 GACACAGAAGTCAACACAGTGGG + Intronic
1070992458 10:80744476-80744498 GGAACTAAAGAGAACACAGAAGG + Intergenic
1072029113 10:91500128-91500150 AACTCTACAGTGCACACAGGAGG + Intronic
1072873359 10:99145012-99145034 GTCACTGAAGAGAGCACAGGAGG + Intronic
1075646716 10:124101610-124101632 GACACTGAAATATACACAGGTGG + Intergenic
1077052739 11:575120-575142 GGCTCTAAGCTGAACACAGGCGG - Intergenic
1077573605 11:3359634-3359656 CACACCTCAGTGAACACAGGAGG - Exonic
1078102495 11:8338085-8338107 GCCACTATAGTGAACAAAAGGGG - Intergenic
1083898594 11:65632807-65632829 GACACTGCAGTGAACCCAGATGG - Intronic
1083942619 11:65905169-65905191 GAGACTCAATTGAACCCAGGAGG - Intergenic
1088245961 11:107818441-107818463 GAGATTAGAGAGAACACAGGTGG - Intronic
1091029821 11:132175675-132175697 GAGAATGAAGTGAACCCAGGAGG - Intronic
1092586797 12:9908770-9908792 GACCCTATAAAGAACACAGGGGG - Intronic
1092732941 12:11551291-11551313 GACAATAGCGTGAACCCAGGAGG + Intergenic
1093432880 12:19104137-19104159 GAACCTAAACAGAACACAGGTGG + Intergenic
1093589673 12:20886465-20886487 GACACTAAAGGAAACTGAGGAGG + Intronic
1094028901 12:25988251-25988273 GACCATAAAGGGAACACAGTGGG + Intronic
1095311120 12:40698323-40698345 GAAAATAATGTGAACCCAGGAGG - Intronic
1095662308 12:44751637-44751659 GACTCCAAAGTAAACACAGGAGG - Intronic
1096256331 12:50064253-50064275 GTGCCTAAACTGAACACAGGTGG + Intronic
1096418483 12:51434716-51434738 GACACCACAGAGAACACAGTGGG - Intronic
1096739957 12:53685837-53685859 GACAGTAAAATGACTACAGGTGG + Intergenic
1097886605 12:64735018-64735040 GACAATAGCGTGAACCCAGGAGG + Intronic
1098185358 12:67890674-67890696 ATCACTAGAGTGGACACAGGAGG + Intergenic
1101044608 12:100791682-100791704 GACACTGATTTGAACATAGGAGG - Intronic
1103102643 12:118193140-118193162 GGCACAAAAATGAACCCAGGAGG - Intronic
1103313732 12:120034358-120034380 GACACTAAAATTAACACAGAGGG + Intronic
1104309325 12:127640086-127640108 GACACTACATTGCACAAAGGTGG - Intergenic
1105358311 13:19680690-19680712 GACACCATCTTGAACACAGGTGG + Intronic
1105835351 13:24206271-24206293 GACACTAAAGAAGACACATGTGG + Intronic
1106007277 13:25782827-25782849 GAGAATCAAGTGAACCCAGGAGG - Intronic
1106808571 13:33336375-33336397 GGCACCCAAGTGGACACAGGTGG - Intronic
1108218366 13:48207813-48207835 GAGATTAAAGTAAAGACAGGTGG + Intergenic
1109174607 13:59139600-59139622 GACACTTAATTGGACACTGGTGG - Intergenic
1109476579 13:62887100-62887122 ACCACTAAAGTGAACACACACGG - Intergenic
1115103071 14:29726527-29726549 GACACTTATGTCAATACAGGTGG + Intronic
1117357748 14:54942159-54942181 GAGACTAGAGTGAACCCGGGAGG + Intronic
1120486332 14:85118165-85118187 AACAGTAAGGTGAACACAGAAGG - Intergenic
1120677031 14:87432454-87432476 GACACTAAACTGAAGAAATGTGG - Intergenic
1120885929 14:89451942-89451964 GAGGCTACAGTGAACTCAGGCGG - Intronic
1120886031 14:89452448-89452470 TGCACTAATGTGGACACAGGAGG + Intronic
1123010073 14:105345315-105345337 GACAATAGCGTGAACCCAGGAGG + Intronic
1124206037 15:27721420-27721442 GACACTACAGAAAACTCAGGAGG + Intergenic
1125460333 15:39900645-39900667 GGCACAAAAGAGAACAGAGGGGG - Intronic
1126371303 15:47950075-47950097 GAGACTAAAGCGATCCCAGGCGG - Intergenic
1126726946 15:51641146-51641168 GACAATGACGTGAACCCAGGAGG + Intergenic
1127118388 15:55749567-55749589 GAGAATCACGTGAACACAGGAGG + Intergenic
1129173202 15:73820587-73820609 GAGACTAGCGTGAACCCAGGAGG + Intergenic
1133907935 16:10038756-10038778 GACAATCACGTGAACCCAGGAGG + Intronic
1134081636 16:11328734-11328756 GACACTTGAGTGAACCCAGCTGG - Intronic
1134269909 16:12724156-12724178 GCCACCACTGTGAACACAGGAGG - Intronic
1135857246 16:26023066-26023088 TACACTGAAGTGAATACAGTTGG - Intronic
1137405187 16:48183671-48183693 GAGAATCAAGTGAACCCAGGAGG + Intronic
1139064774 16:63299115-63299137 GACATTAAAATGAATACAGATGG + Intergenic
1141056669 16:80822498-80822520 AACACTAAATGGAACAAAGGGGG + Intergenic
1141213578 16:82003564-82003586 CACACTGAAGTGAGAACAGGAGG - Intronic
1145179349 17:20732072-20732094 GACAATCACTTGAACACAGGAGG - Intergenic
1146691544 17:34879627-34879649 GATAGTAAAGGGAACACAGAAGG + Intergenic
1151532404 17:74715030-74715052 GAGAATAACTTGAACACAGGAGG + Intronic
1152711603 17:81873127-81873149 GACACAGACATGAACACAGGAGG + Intergenic
1155031717 18:21990834-21990856 GAGAATAATGTGAACCCAGGAGG - Intergenic
1155339768 18:24802179-24802201 TACAAAAAAGAGAACACAGGAGG + Intergenic
1155603120 18:27572273-27572295 GACACTAAAGAGAATACGGTGGG + Intergenic
1156501490 18:37562337-37562359 AAAACTAAATTAAACACAGGAGG - Intronic
1159802496 18:72919098-72919120 GAGCCTTGAGTGAACACAGGTGG - Intergenic
1159849608 18:73511982-73512004 TACACTGAAGTAAACAGAGGAGG - Intergenic
1161971912 19:7586748-7586770 GAGAATCATGTGAACACAGGAGG + Intergenic
1164436522 19:28235280-28235302 AACCCAAAAGTGAACAGAGGAGG + Intergenic
1165586935 19:36925034-36925056 GACACTGAAATGGACACAGATGG - Intronic
1166514317 19:43434760-43434782 GAGAGTCAAGTGAACCCAGGAGG - Intergenic
1167083230 19:47291404-47291426 GAGCCTAGAGTGAACATAGGTGG + Intronic
927118633 2:19930392-19930414 GACACTGCACTGAAGACAGGTGG - Exonic
927202520 2:20587265-20587287 GAAACGAAAGTGAAAAAAGGAGG + Intronic
928537752 2:32257040-32257062 GGCCCTAAAGAGAACCCAGGCGG + Intronic
930768314 2:55107642-55107664 GACACAAAAGTGAGCAGAGATGG + Intronic
931318663 2:61155608-61155630 GAGAATAGAGTGAACGCAGGAGG - Intronic
933235354 2:79858571-79858593 CACACTAAGGTGGGCACAGGTGG - Intronic
936039241 2:109137011-109137033 TACACTACAGTGGACACTGGGGG + Intronic
936608253 2:113978465-113978487 GACAGTAAAGCAAACCCAGGCGG + Intergenic
936813984 2:116436700-116436722 GAGAATGAAGTGAACCCAGGAGG + Intergenic
936872221 2:117146666-117146688 GACAATAACTTGAACCCAGGAGG + Intergenic
939302674 2:140366126-140366148 GACAGTAAAGACAACACTGGAGG + Intronic
945826396 2:214725121-214725143 ACCAGTAAAGTGAATACAGGAGG + Intergenic
1169146235 20:3254423-3254445 GACACTAAATAGGAAACAGGAGG - Intronic
1169225547 20:3854333-3854355 GAGACTCAATTGAACCCAGGAGG + Intronic
1169477974 20:5949839-5949861 GATCCTAAAGTGAAGAAAGGAGG + Intronic
1171538803 20:25926528-25926550 GAGAATAACTTGAACACAGGAGG + Intergenic
1171558650 20:26099928-26099950 GAGAATGAAGTGAACCCAGGAGG - Intergenic
1173663130 20:44747646-44747668 GAGACTCAAGTGGAAACAGGAGG + Intronic
1174014764 20:47478846-47478868 GAGACTCACTTGAACACAGGAGG + Intergenic
1175223299 20:57430162-57430184 GACACTGAGGTGAACAGAGAGGG + Intergenic
1176912163 21:14579124-14579146 GACACTAAAGTGAAAGAAGTTGG - Intronic
1177790823 21:25720537-25720559 GAGACTTACGTGAACCCAGGAGG - Intronic
1179900931 21:44393960-44393982 GAGACTCAATTGAACCCAGGAGG - Intronic
1182343246 22:29641524-29641546 GACACTGAAATAAACACAGCAGG - Intronic
1183049883 22:35252123-35252145 GACACTCACTTGAACCCAGGAGG + Intergenic
1184838439 22:47038018-47038040 GACACTCAAGGGAAGAGAGGTGG - Intronic
1185068431 22:48643475-48643497 CACACCAAAGTGCACACTGGAGG - Intronic
949128653 3:475465-475487 GACACTGGCGTGAACCCAGGGGG - Intergenic
954979467 3:54731441-54731463 GACACTTAAATGTACACAAGTGG - Intronic
957881407 3:86218534-86218556 GAGAATGAAGTGAATACAGGAGG - Intergenic
958655053 3:96990694-96990716 TACTCTAAAATGAACACTGGTGG - Intronic
961000176 3:123368785-123368807 GACACAACAGTGAGCAGAGGAGG - Intronic
962506470 3:136051417-136051439 GACAATCAATTGAACCCAGGAGG - Intronic
965260565 3:166478468-166478490 GAGACTTGAGTGAACATAGGTGG + Intergenic
965469976 3:169078822-169078844 GAGACTCACGTGAACACAAGAGG - Intergenic
969077139 4:4589107-4589129 GGCACTACAGAGACCACAGGGGG + Intergenic
969198190 4:5579749-5579771 GACAATCAATTGAACCCAGGAGG + Intronic
970368526 4:15385332-15385354 GACAGAAAAGTGTAGACAGGTGG + Intronic
970604752 4:17668620-17668642 GAGACTCACTTGAACACAGGAGG - Intronic
972141687 4:35968320-35968342 GAGAATCAACTGAACACAGGAGG + Intronic
972303991 4:37814093-37814115 GACACCAAAGTGAAGATAGGAGG - Intergenic
974892016 4:67894165-67894187 GAGACTGGAGTGAACCCAGGAGG - Intergenic
976578410 4:86704092-86704114 GAGAATCAAGTGAACCCAGGAGG + Intronic
978617664 4:110612571-110612593 GACACCAAAGTGGACAGAGGTGG - Intergenic
980336382 4:131479198-131479220 GACTATAAAGTGAAGGCAGGAGG - Intergenic
982169000 4:152643418-152643440 GACAAAAAAGGGAACCCAGGAGG + Intronic
984138242 4:175969221-175969243 GACAATAAAGTGATCAGTGGTGG + Intronic
985298402 4:188459854-188459876 TATACTAATGTGTACACAGGGGG - Intergenic
986714729 5:10514721-10514743 GAGAATCACGTGAACACAGGAGG - Intronic
988116722 5:26902569-26902591 GAGACTTTAGTGAACACAGGAGG + Exonic
990677461 5:58203841-58203863 GGCACTACAGTCAACACATGGGG - Intergenic
990843751 5:60113357-60113379 ATCACAAAAGTGAACACAGATGG + Intronic
994683337 5:102917606-102917628 AACACTGAAGTGTAAACAGGAGG - Intronic
998923415 5:147096166-147096188 GAAACAAGAGTGAAAACAGGAGG + Intergenic
1001150775 5:169225695-169225717 GCCACAAAAGAGAAGACAGGGGG + Intronic
1001344845 5:170884718-170884740 GAATTTAAAGTGAACACAGAAGG - Intronic
1003893559 6:10585394-10585416 AACACTAAAATGAAAAGAGGTGG + Intronic
1004870920 6:19903077-19903099 GAAACTAGAGGGAACACAGAAGG + Intergenic
1006631162 6:35430928-35430950 GAGAATAGAGTGAACCCAGGAGG + Intergenic
1007197534 6:40075555-40075577 GGCACTGGAGTGAACACATGTGG + Intergenic
1007749768 6:44064730-44064752 GACAATGAAGTGACCACAGGCGG + Intergenic
1008362946 6:50643256-50643278 GAGAATGAAGTGAACCCAGGAGG + Intergenic
1008433680 6:51450175-51450197 GAGACTAAAGTCAAAAGAGGAGG + Intergenic
1008810175 6:55487150-55487172 GAGACTAAAGAGAACACTGTTGG - Intronic
1010958391 6:82117733-82117755 GACAGTCAAGTGAACTCAGGAGG - Intergenic
1016654266 6:146499914-146499936 GCCTCGAAAGTGAACACTGGAGG - Intergenic
1017690726 6:156961522-156961544 GACAGTCAGGTGAGCACAGGTGG + Intronic
1017851155 6:158307569-158307591 GACAATCAATTGAACCCAGGAGG - Intronic
1018219377 6:161563005-161563027 GACACTAAATTAAACCAAGGTGG - Intronic
1018293229 6:162314619-162314641 CACACTAATGTGACCACAAGAGG - Intronic
1018541448 6:164884307-164884329 GACAATCAAGTGAACCCAGGAGG - Intergenic
1018815247 6:167325513-167325535 GAGACTAAAGTTACCAAAGGAGG + Intronic
1020134145 7:5576837-5576859 GAGAATGAAGTGAACCCAGGAGG + Intergenic
1020440753 7:8214221-8214243 GACACTTAATTGACCACAGGAGG + Intronic
1020722452 7:11764489-11764511 GAGAATAATGTGAACCCAGGAGG + Intronic
1020807114 7:12803797-12803819 GACACATATGTGAACACAGACGG + Intergenic
1023888519 7:44376946-44376968 GACACTCAGATGGACACAGGAGG - Intergenic
1024577813 7:50779174-50779196 GACACTAAAGTGAACACAGGGGG + Intronic
1025117570 7:56271255-56271277 GATAATAAAGTGAGCACACGTGG + Intergenic
1026201566 7:68218828-68218850 GATAGTAAAGTGAGCACATGTGG + Intergenic
1028531902 7:91847797-91847819 CACACAAAAGTAAACACAGATGG + Intronic
1028711941 7:93919519-93919541 GAGAATAACGTGAACCCAGGAGG + Intergenic
1028724689 7:94073989-94074011 GAGACTCAATTGAACCCAGGAGG - Intergenic
1032528239 7:132596477-132596499 GAAACTATAGTGAGCACAGCTGG + Intronic
1035406196 7:158599255-158599277 GAGAATGAAGTGAACCCAGGAGG - Intergenic
1036482262 8:9150092-9150114 AAAACTAAAGTGAAGACAGCTGG - Intronic
1039042445 8:33421008-33421030 GACACTATAGGAAAGACAGGTGG + Intronic
1039908903 8:41808573-41808595 GAGAATCAAGTGAACCCAGGAGG + Intronic
1043130484 8:76454918-76454940 CAGACTACAGTGAACAGAGGTGG + Intergenic
1044044024 8:87407283-87407305 AACACAAAAGTGGACAAAGGAGG - Intronic
1044136883 8:88596723-88596745 GAAACAAAAGTGAACAGAAGAGG + Intergenic
1045598946 8:103692212-103692234 GAACCTTGAGTGAACACAGGTGG - Intronic
1047087207 8:121531119-121531141 AACACTACACAGAACACAGGAGG + Intergenic
1048283563 8:133123450-133123472 GGCATTAGAGAGAACACAGGAGG - Intronic
1052732926 9:32310857-32310879 GGGCCTTAAGTGAACACAGGTGG + Intergenic
1058941437 9:109816350-109816372 GACATAAAAATGAAGACAGGAGG + Intronic
1060961085 9:127681216-127681238 GACGCAAAAGAGAAGACAGGTGG - Intronic
1062239836 9:135531013-135531035 CACTATAAAGAGAACACAGGAGG + Intergenic
1193529706 X:82642088-82642110 GACACTTAAGTGAACATTGCTGG - Intergenic
1194004303 X:88471195-88471217 GAGAATAACGTGAACCCAGGAGG + Intergenic
1194239187 X:91422897-91422919 GTCACTAGAGTGGACCCAGGTGG - Intergenic
1196247540 X:113416854-113416876 GAAATTAAAGAGAACACAGAAGG + Intergenic
1197627001 X:128813415-128813437 GACATTAAAGAGAACAAAGAGGG + Intergenic
1197899367 X:131353685-131353707 GTCACTGAAGTGAGCACAAGTGG + Intronic
1200984295 Y:9289739-9289761 GCAACTCCAGTGAACACAGGTGG + Intergenic
1201591837 Y:15623998-15624020 CACACTACAGTTAAAACAGGAGG - Intergenic
1202126148 Y:21570500-21570522 GCAACTCCAGTGAACACAGGTGG - Intergenic
1202152856 Y:21858906-21858928 GCAACTCCAGTGAACACAGGTGG + Intergenic