ID: 1024578305

View in Genome Browser
Species Human (GRCh38)
Location 7:50782393-50782415
Sequence GTGGGCTCCGCCGCGGGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 249}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024578305_1024578312 -3 Left 1024578305 7:50782393-50782415 CCAGCGCCCGCGGCGGAGCCCAC 0: 1
1: 0
2: 1
3: 22
4: 249
Right 1024578312 7:50782413-50782435 CACCTGAGTACCTGGAGAGCGGG 0: 1
1: 0
2: 0
3: 31
4: 323
1024578305_1024578317 17 Left 1024578305 7:50782393-50782415 CCAGCGCCCGCGGCGGAGCCCAC 0: 1
1: 0
2: 1
3: 22
4: 249
Right 1024578317 7:50782433-50782455 GGGCGGCAGCACTGGCCGCACGG 0: 1
1: 0
2: 0
3: 16
4: 224
1024578305_1024578316 9 Left 1024578305 7:50782393-50782415 CCAGCGCCCGCGGCGGAGCCCAC 0: 1
1: 0
2: 1
3: 22
4: 249
Right 1024578316 7:50782425-50782447 TGGAGAGCGGGCGGCAGCACTGG 0: 1
1: 0
2: 2
3: 19
4: 217
1024578305_1024578314 0 Left 1024578305 7:50782393-50782415 CCAGCGCCCGCGGCGGAGCCCAC 0: 1
1: 0
2: 1
3: 22
4: 249
Right 1024578314 7:50782416-50782438 CTGAGTACCTGGAGAGCGGGCGG 0: 1
1: 0
2: 1
3: 21
4: 266
1024578305_1024578319 19 Left 1024578305 7:50782393-50782415 CCAGCGCCCGCGGCGGAGCCCAC 0: 1
1: 0
2: 1
3: 22
4: 249
Right 1024578319 7:50782435-50782457 GCGGCAGCACTGGCCGCACGGGG 0: 1
1: 0
2: 0
3: 18
4: 120
1024578305_1024578318 18 Left 1024578305 7:50782393-50782415 CCAGCGCCCGCGGCGGAGCCCAC 0: 1
1: 0
2: 1
3: 22
4: 249
Right 1024578318 7:50782434-50782456 GGCGGCAGCACTGGCCGCACGGG 0: 1
1: 0
2: 3
3: 19
4: 178
1024578305_1024578311 -4 Left 1024578305 7:50782393-50782415 CCAGCGCCCGCGGCGGAGCCCAC 0: 1
1: 0
2: 1
3: 22
4: 249
Right 1024578311 7:50782412-50782434 CCACCTGAGTACCTGGAGAGCGG 0: 1
1: 1
2: 2
3: 30
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024578305 Original CRISPR GTGGGCTCCGCCGCGGGCGC TGG (reversed) Intronic
900245846 1:1635783-1635805 GGGGCCTCTGCCGCGGGCCCCGG - Exonic
900257071 1:1702926-1702948 GGGGCCTCTGCCGCGGGCCCCGG - Exonic
900393444 1:2443658-2443680 GCGGGCTCCGCGGCGGGCACCGG - Intronic
900629350 1:3625332-3625354 GTGGGGTCGGAGGCGGGCGCCGG + Intronic
901279901 1:8026077-8026099 GGGGGCCCCGCGCCGGGCGCCGG - Intronic
901930785 1:12595382-12595404 GTGGGCCCAGGGGCGGGCGCGGG + Intronic
902067466 1:13700212-13700234 GGCGGCGCGGCCGCGGGCGCCGG + Intronic
904171097 1:28592626-28592648 GTGGGCTCGGGCTCGGGCTCCGG - Intronic
905670859 1:39789091-39789113 GTGGCTTCCGCCGCGGGCCTCGG + Intergenic
905806986 1:40884389-40884411 GTGCCCTCTGCCGCGGGCGGCGG - Intergenic
906315518 1:44784403-44784425 GGGGTCTGCGCGGCGGGCGCGGG + Exonic
908355880 1:63324232-63324254 GGGGGCTCGGCGGTGGGCGCTGG + Exonic
914523044 1:148435072-148435094 GTGGCCCCCGCCGCCGGCCCTGG + Intergenic
914869121 1:151458817-151458839 GCGCGCGCCGCGGCGGGCGCCGG + Intronic
915553345 1:156647574-156647596 GTGGGCTCCAATGCGGGCACAGG - Exonic
922440736 1:225653270-225653292 GGGGGCCCGGCCGCCGGCGCGGG - Intergenic
922721435 1:227902056-227902078 GTGGGCTCAGCCTGGGGGGCGGG - Intergenic
924524587 1:244835234-244835256 GTGGGCCCCACCGCGGGGGTCGG - Intergenic
924539925 1:244970819-244970841 GCGGGCTGCGCCGGAGGCGCCGG + Exonic
1063379621 10:5576087-5576109 CTGGCATCCGCTGCGGGCGCTGG - Intergenic
1063565999 10:7172499-7172521 GTGGACTTCACCGCGGGCTCGGG - Exonic
1064086697 10:12350500-12350522 GCGGGCTCGGCCGCACGCGCCGG + Intronic
1064354389 10:14604284-14604306 CTGGGCGCCGCCGCGGGCGCCGG - Intronic
1069604080 10:69729051-69729073 TTGGCCTCCACCTCGGGCGCAGG + Intergenic
1071695110 10:87862607-87862629 GGGGGCACCGGAGCGGGCGCAGG + Exonic
1072102207 10:92239824-92239846 GCCGGCTGCGGCGCGGGCGCAGG + Exonic
1072294232 10:93994000-93994022 GTGGGCAACGCGGCGGGCGGCGG + Intronic
1072654301 10:97319654-97319676 GGGGGCGCCGCTGCGGGCCCCGG + Exonic
1072734114 10:97867581-97867603 GTGGGCTCCACCGCAGCCCCTGG + Exonic
1072926339 10:99620339-99620361 GTGGGCGCCGCAGCTGGCCCGGG - Exonic
1073325743 10:102643414-102643436 TTGGGCTCCGCGGCGGCGGCCGG - Intergenic
1073792597 10:106955289-106955311 GGGGCCTCCGCCTTGGGCGCTGG - Intronic
1076597851 10:131637002-131637024 GTGGGCTCCGCCGCTGACCACGG + Intergenic
1076793639 10:132788761-132788783 GCGGGCTCCGGCCCGGGCGCGGG + Intergenic
1077201471 11:1309555-1309577 GCAGGCTCCGGCGGGGGCGCAGG - Exonic
1081832080 11:46122092-46122114 GGGGGGGCCGCCGCGGGCTCCGG - Intergenic
1082028751 11:47590227-47590249 GTGGGCTCGGACGCTGGCCCCGG - Exonic
1083885700 11:65572568-65572590 CTGGGCTCCGGCGGGGCCGCGGG + Exonic
1084763823 11:71294570-71294592 GTGGGCTCCCCCTCTGGCCCAGG + Intergenic
1086951732 11:92897671-92897693 GTGAGCTCTGCTGCTGGCGCAGG - Intergenic
1091124573 11:133083003-133083025 GGGGCGTCCGCCGCGGGCTCCGG - Intronic
1091616147 12:2052753-2052775 GGCGGCGCTGCCGCGGGCGCCGG + Intronic
1095431955 12:42144385-42144407 GTGGGGGACGCGGCGGGCGCGGG - Intronic
1095810995 12:46372937-46372959 CGGGGCTGGGCCGCGGGCGCGGG - Intergenic
1102505985 12:113384898-113384920 GTGGGCCCAGCCCCGGGAGCCGG + Exonic
1103432954 12:120903881-120903903 GTGGGCTCCGCTGCAGGCTGTGG + Exonic
1104409227 12:128544074-128544096 GTGGGCTGGGCCCCAGGCGCTGG - Exonic
1105525700 13:21176321-21176343 GTGGGGTGCGCCGCGGGCGGAGG - Intronic
1107468026 13:40666651-40666673 GCGCGCGCCGCCGCGGGCGGGGG - Intergenic
1107865203 13:44696417-44696439 GTGGGCTGGGCCGGGGGCGGTGG + Intergenic
1112216221 13:97434019-97434041 GCGGGCTCCGCCCCGGCCGCCGG + Intergenic
1113625144 13:111789448-111789470 GTGGGCTCCTCCGGGAGGGCAGG + Intergenic
1116820424 14:49621417-49621439 GTGGTCCCCACCGCGGCCGCCGG - Exonic
1116928599 14:50668008-50668030 TAGGGCTCCGCGCCGGGCGCCGG + Exonic
1117309784 14:54509914-54509936 CTGGGCTCCGCGGCTGGAGCCGG + Exonic
1118904817 14:70016114-70016136 GTGGGCTCTGCCGCAGGTGGGGG + Intronic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1121648171 14:95535183-95535205 GCGGGCTCGGGCGCGGGCGGCGG + Exonic
1122688954 14:103522623-103522645 GCGGGGTCCGCAGCGCGCGCGGG + Intronic
1122969567 14:105147038-105147060 GTGGGCTCCTCTGTGGCCGCAGG - Intronic
1124629220 15:31327507-31327529 GTGGGCTCGGGGGCGGGCGGCGG - Exonic
1125543813 15:40488252-40488274 CTGGGCTCTGCAGCAGGCGCGGG + Intergenic
1127117582 15:55743186-55743208 GTGGACAGCGCCGCGGCCGCGGG + Intergenic
1128374574 15:67065942-67065964 GTGGGAGCCGCTCCGGGCGCAGG + Exonic
1128548651 15:68583857-68583879 GTGGGCTCCCACCCGGGAGCTGG - Intronic
1129675997 15:77632680-77632702 GCGCGCTCCGCCGCGGGGCCGGG + Intronic
1131272261 15:90954699-90954721 GTGGCCTCCGCTGAGGGCGCTGG + Intergenic
1132569211 16:636865-636887 GCGTGCGCCGCCGCTGGCGCCGG + Intronic
1132616455 16:843311-843333 GTGGTCTTCGCCGCTGGCTCTGG - Intergenic
1132779334 16:1614282-1614304 GGGAGCCCCGGCGCGGGCGCGGG - Intronic
1132836138 16:1954364-1954386 GTGGGCTCAGCCTGGGGCCCAGG + Intronic
1135354351 16:21757144-21757166 GTGGACTGAGCCGCCGGCGCTGG - Exonic
1135452842 16:22573284-22573306 GTGGACTGAGCCGCCGGCGCTGG - Intergenic
1136719716 16:32310379-32310401 GTGGGCTCCGGCGCCAGCGGCGG + Intergenic
1136778891 16:32885280-32885302 GTGGGCTTCGCCGTGGGCCTGGG - Intergenic
1136838091 16:33516659-33516681 GTGGGCTCCGGCGCCAGCGGCGG + Intergenic
1137988403 16:53130167-53130189 TGGGTCTCCGCGGCGGGCGCCGG + Intronic
1138179337 16:54931456-54931478 GCGGGATCCGCGGCGGGCGAGGG + Intronic
1138478063 16:57283809-57283831 GTGGGCGCCCGCGCGGGAGCCGG - Intronic
1141660642 16:85439322-85439344 GTGGGGGCGGCCTCGGGCGCTGG + Intergenic
1142395349 16:89828572-89828594 GGCGGCGCCGCGGCGGGCGCAGG + Exonic
1203006715 16_KI270728v1_random:207390-207412 GTGGGCTCCGGCGCCAGCGGCGG - Intergenic
1203148264 16_KI270728v1_random:1816939-1816961 GTGGGCTCCGGCGCCAGCGGCGG + Intergenic
1142509503 17:385336-385358 GAGGCCTCTGCCGGGGGCGCTGG - Intronic
1142509640 17:385755-385777 GTGCGCGCCGGGGCGGGCGCTGG + Intronic
1142560266 17:805334-805356 GTGGGCTCCACCACGGTCGGGGG - Intronic
1142762272 17:2049763-2049785 GTGGACTCAGCCGCCGGCCCCGG + Intergenic
1143448416 17:7022078-7022100 GTGCGCTCAGACCCGGGCGCAGG - Intergenic
1143524200 17:7462900-7462922 GTGGGCTGCCCCGAGGCCGCCGG - Exonic
1147612798 17:41811647-41811669 TCGGGCTTGGCCGCGGGCGCGGG + Exonic
1147742104 17:42675563-42675585 GCGGGCTGCGCCGCCGGGGCCGG - Intronic
1147996761 17:44363817-44363839 GCGGGCGCCGCAGCGGGAGCGGG - Exonic
1148183050 17:45620531-45620553 GCGGGCGCCGCCGAGGGCCCTGG + Intergenic
1148265803 17:46225160-46225182 GCGGGCGCCGCCGAGGGCCCTGG - Intronic
1150830282 17:68512553-68512575 GTGGGGTCGGCCGGGGGCTCAGG + Exonic
1151854410 17:76710795-76710817 GTGGCCTCGGCCGGGGGCGCGGG + Exonic
1152924541 17:83081038-83081060 GGAGGCTCCGCCGGGGGCGCTGG - Intronic
1156350705 18:36298540-36298562 GGGGGCGCCGCCGGGGACGCCGG + Intronic
1157384229 18:47248078-47248100 GTGGGCGCGGGCGCGGGGGCGGG - Intronic
1157384233 18:47248084-47248106 GTGGGCGTGGGCGCGGGCGCGGG - Intronic
1158976597 18:62716012-62716034 GTTGGCGCCGCCGCCGGCCCCGG - Exonic
1160662018 19:305731-305753 GTGGGGTCCTCCGTGGGCGGCGG - Exonic
1160680340 19:409215-409237 GGGGGCGCGGGCGCGGGCGCGGG - Intergenic
1160730624 19:640215-640237 CGGGACTCCCCCGCGGGCGCAGG - Intronic
1160765188 19:804484-804506 GTGGGCCCAGCCGCAGGGGCCGG + Intronic
1160864331 19:1250366-1250388 ATGGGCGCCGCCTCGGCCGCCGG - Exonic
1160991941 19:1863676-1863698 GTGGCCGCCCCCGCGGGCTCCGG - Intergenic
1160992205 19:1864414-1864436 CCGGGCCCCGCCGCGGGCGCGGG - Intergenic
1160994388 19:1875982-1876004 GTGGGGGCCGCCGCGGGGTCGGG - Intergenic
1162802334 19:13118401-13118423 GCGGGCTCCGCAGCGGCGGCTGG - Exonic
1163606935 19:18280862-18280884 GCGGGCGGCGCCGGGGGCGCGGG - Exonic
1164429929 19:28178122-28178144 GTAGGCTCCACCTCGGGGGCAGG + Intergenic
1165056116 19:33177258-33177280 GTGGCCTCGGCCACGGGGGCGGG + Intergenic
1165772031 19:38385700-38385722 ATGGGCGCAGCCGCGGGTGCGGG + Exonic
1166304103 19:41928013-41928035 GTGAGCGCCGCGGCCGGCGCAGG - Intronic
1166358704 19:42242598-42242620 GCGTGCCCCGCGGCGGGCGCTGG - Intronic
1167045367 19:47046135-47046157 GGGGGCGCGGCCGTGGGCGCGGG - Exonic
1167766788 19:51488659-51488681 GTGGGCTCCTCCCTGGGGGCAGG + Intronic
924962257 2:45898-45920 GCGGGGTCCGCCGCGGGGCCAGG + Exonic
925610423 2:5696917-5696939 GGGGGCTCCGGCGGCGGCGCGGG + Exonic
926152867 2:10434551-10434573 GTGGGCTCTGCCTCTGGCTCAGG + Intergenic
929604667 2:43226559-43226581 GTCGGCTCCGCGGGGGGGGCGGG - Exonic
929788728 2:45009271-45009293 GTGGGACCCGCGGCCGGCGCGGG - Exonic
930700787 2:54456573-54456595 GTGGGCTCCGCGGCGGCGGACGG + Intronic
931253666 2:60553272-60553294 GTGGGCTGCGGGGCGGGCGGCGG + Exonic
933666875 2:84971324-84971346 CCGGGCTCGGCCGCGGGGGCGGG - Exonic
936038324 2:109129646-109129668 GCGGCCACCGCCGCGGGGGCGGG + Exonic
937134941 2:119544459-119544481 GCGGGCGCCGGCGCTGGCGCCGG + Exonic
939969616 2:148644818-148644840 GTGGAGGCGGCCGCGGGCGCGGG + Intronic
940993902 2:160126477-160126499 GAGTGCTCTGCAGCGGGCGCGGG - Exonic
941020934 2:160407556-160407578 GCGGGCGCGGGCGCGGGCGCGGG + Intronic
941104918 2:161341175-161341197 GTGGCCTCGGCCGGGGGCGCGGG + Intronic
942043001 2:172083263-172083285 GTGATCGCCGCGGCGGGCGCGGG - Intergenic
942276380 2:174326719-174326741 GGGCGCTCCGCCGAGGGCGCGGG + Intergenic
946239466 2:218344987-218345009 GTGGGCTGGGCTGGGGGCGCTGG - Exonic
946401760 2:219472116-219472138 GGGGGCTCAGCCGCAGGGGCAGG - Intronic
946404391 2:219484705-219484727 GAGGGGTCCGCCGCAGCCGCTGG - Exonic
947860617 2:233354839-233354861 GCGCGCTCCGCCCGGGGCGCCGG - Intronic
947872479 2:233447126-233447148 GTGGGCACCGCGGCGGGGGAGGG - Intronic
948823158 2:240560518-240560540 CTTGGGTCCCCCGCGGGCGCTGG - Exonic
949019675 2:241734292-241734314 GTGGGCTCGGCCGAGGGACCTGG - Intergenic
1169278490 20:4248875-4248897 GGGGGCTCCAGCGCGGGCGGCGG - Exonic
1173820158 20:46014275-46014297 GTGAGCGCCGCCGCGGCCGCCGG + Intronic
1173843658 20:46174837-46174859 GGGGGCTCGGGCGGGGGCGCGGG - Exonic
1175237678 20:57525503-57525525 GAGGGCCCCGCAGGGGGCGCTGG + Intronic
1175367685 20:58467108-58467130 GTGCGCTCTGCAGCGGGCGCTGG + Exonic
1175793744 20:61758360-61758382 GTGTGCTCTGCCTCGGGCCCTGG + Intronic
1176144203 20:63558316-63558338 GTGGGCTGCGCAGTGGGCTCGGG - Intronic
1178915778 21:36704918-36704940 GAGGGCTCCGACGCGGGAGAAGG + Intronic
1179444227 21:41420286-41420308 GGGGGCGCGGGCGCGGGCGCGGG + Intronic
1179622447 21:42626234-42626256 GTGGGCTCCGCCGCACGTGGTGG + Intergenic
1180791380 22:18577338-18577360 GAGGGGGCGGCCGCGGGCGCAGG + Intergenic
1181124953 22:20696678-20696700 CTGGGCTCCCCCGCAGGTGCCGG + Intergenic
1181188204 22:21121025-21121047 CTGGGCTCCCCCGCAGGTGCCGG - Intergenic
1181210994 22:21289468-21289490 CTGGGCTCCCCCGCAGGTGCCGG + Intergenic
1181248291 22:21516890-21516912 GAGGGGGCGGCCGCGGGCGCAGG + Intergenic
1181398506 22:22637420-22637442 CTGGGCTCCCCCGCAGGTGCCGG - Intergenic
1181514363 22:23402665-23402687 CTGGGCGCCGGCGCGGGCGCGGG + Intergenic
1181694481 22:24586026-24586048 GCTGGCTCAGCCGCCGGCGCAGG + Exonic
1181706472 22:24652099-24652121 CTGGGCTCCCCCGCAGGTGCCGG - Intergenic
1182904055 22:33921081-33921103 GCGGGCGCCGACGCGGGCGCCGG - Intronic
1183698719 22:39437870-39437892 GTGGGCTCTGCACCGGGCCCTGG + Intergenic
1184337511 22:43862436-43862458 GCGGGCGCGGGCGCGGGCGCGGG - Exonic
1184767796 22:46580675-46580697 GTGGGTTTCGCCGGGCGCGCTGG + Intronic
1185255204 22:49827760-49827782 GCGGGCGCGGGCGCGGGCGCGGG + Intergenic
1185335772 22:50270334-50270356 CTCGGCTCGGGCGCGGGCGCGGG - Exonic
1203215952 22_KI270731v1_random:5962-5984 CTGGGCTCCCCCGCAGGTGCCGG - Intergenic
1203274671 22_KI270734v1_random:79428-79450 CTGGGCTCCCCCGCAGGTGCCGG + Intergenic
950078943 3:10207528-10207550 GGGGGCTCCTCGGTGGGCGCAGG - Intronic
950079031 3:10208091-10208113 GGGGGCTCCTCGGTGGGCGCAGG + Intronic
952970994 3:38649869-38649891 GTGTGCGCCCCGGCGGGCGCTGG - Intergenic
953309501 3:41863344-41863366 GTGGGCTCCCCCTCTGGCCCAGG + Intronic
953863690 3:46565840-46565862 TTGGGCTCAGCCTTGGGCGCCGG + Intronic
954782689 3:53072884-53072906 GTGGGCTCCTCTGAGGTCGCGGG - Intronic
956678191 3:71754307-71754329 GGGGGCGCCGCCGGGCGCGCTGG + Exonic
966592241 3:181695879-181695901 GTCGGCCCCGCCGCGGCCCCAGG + Intergenic
966594425 3:181712793-181712815 GTGGGCGCCGGCCTGGGCGCGGG + Exonic
966911480 3:184562466-184562488 CTGGGCCCCGGAGCGGGCGCCGG - Intronic
968225216 3:196968834-196968856 GGGGCCGCCGCCGCCGGCGCAGG + Intronic
968504890 4:967160-967182 CCGGGCTCTGCCGCGGGCCCAGG - Exonic
969113371 4:4857074-4857096 CTGGACTCCGCCGCGGGGGGGGG - Intergenic
969493080 4:7510922-7510944 GTGGGCAGCGCCCCGGGAGCTGG + Intronic
973551271 4:52038200-52038222 GTGAGTACCGCCGCGGCCGCGGG - Intronic
974747906 4:66100091-66100113 CTGGGCGCGGCGGCGGGCGCCGG + Intergenic
975701981 4:77075641-77075663 GGGGGCGCGGGCGCGGGCGCTGG + Exonic
981366653 4:143912094-143912116 TAGGGCTCCGCGCCGGGCGCCGG + Intergenic
982257769 4:153466792-153466814 GGGGGCTGCGCCCGGGGCGCAGG - Intronic
984024138 4:174522590-174522612 GTGGGTTCCCCGGCGGGCGCTGG - Exonic
984639299 4:182144619-182144641 GGGGGCCCCGCCGAGGGAGCGGG - Intronic
984928326 4:184825865-184825887 CCGGGCACCGCCGCGGGAGCAGG + Intronic
985068425 4:186144925-186144947 GCGGGCGCGGGCGCGGGCGCGGG + Exonic
985068427 4:186144931-186144953 GCGGGCGCGGGCGCGGGCGCGGG + Exonic
985068429 4:186144937-186144959 GCGGGCGCGGGCGCGGGCGCGGG + Exonic
988949379 5:36241800-36241822 GTGGGCCGGGCCGCGGCCGCGGG + Intronic
989011464 5:36876919-36876941 GGGGGCATCGCCGCGGGCCCGGG - Exonic
990919195 5:60944688-60944710 GGGGGTTCCCCCGCGGGCTCAGG - Intronic
994353877 5:98774029-98774051 GTGGGCTCCGGCGAGGGCGGCGG - Exonic
995764595 5:115602052-115602074 GGGGCCGCCGCCGGGGGCGCGGG - Intronic
996443034 5:123512694-123512716 GGGGGCGGCGCCGCAGGCGCGGG + Intronic
999300013 5:150485530-150485552 CTCGGAGCCGCCGCGGGCGCGGG + Intergenic
1002898109 6:1390698-1390720 GCGGGCTACGACGCCGGCGCGGG + Exonic
1002926768 6:1609687-1609709 CCGGGCGCCGGCGCGGGCGCAGG + Intergenic
1002929185 6:1621524-1621546 GTCCGCTTGGCCGCGGGCGCTGG - Intergenic
1004720586 6:18264675-18264697 GTCGCCTCGGCCGCGGGCGGAGG + Exonic
1007390222 6:41546460-41546482 GGGGGCTCCGTCCCGGCCGCCGG - Exonic
1007600171 6:43076417-43076439 CTGCGCTCCGCGGCGGGCACAGG - Intronic
1013538747 6:111087495-111087517 GTGGGCTCAGTCGGGGGTGCGGG + Intronic
1015843866 6:137497832-137497854 GCGGGCTGCGCCGCGGAGGCGGG + Intergenic
1018769364 6:166957472-166957494 GTGGGCGGGGCCGCGGGTGCAGG - Intergenic
1018959920 6:168441059-168441081 GCGGGCGCGGCAGCGGGCGCTGG + Intergenic
1019171809 6:170137038-170137060 TCGGGCTCGGCCGCGGGTGCGGG - Intergenic
1019426553 7:980190-980212 GTGGGCTCCCCCGGAGGGGCTGG - Intergenic
1019446884 7:1076004-1076026 GTGGACTCAGCCGCTGGAGCTGG - Intronic
1019486019 7:1289535-1289557 GTGGGCTGCGCCCTGGGCCCAGG - Intergenic
1019579475 7:1753234-1753256 GTGGGCTCTGGCGTGGGAGCTGG + Intergenic
1019663897 7:2241916-2241938 CTGGACTCCGCCGCCGGCCCCGG + Intronic
1020418226 7:7969495-7969517 GTGGGCTGCGCCCCGGCTGCGGG + Exonic
1023842378 7:44104627-44104649 GGGGGCTCCGGGGAGGGCGCGGG - Exonic
1024262397 7:47582146-47582168 GGGGGCCCTGCCGCGGGCGCCGG - Intronic
1024578305 7:50782393-50782415 GTGGGCTCCGCCGCGGGCGCTGG - Intronic
1029075059 7:97928410-97928432 GTGGGCACCGGGGCCGGCGCGGG + Intergenic
1029640313 7:101816148-101816170 GCGGCCTCCGCCGGGGGCCCCGG + Intronic
1032525384 7:132575875-132575897 CTGGCCTCCTCCCCGGGCGCTGG + Intronic
1033165566 7:139036004-139036026 GTGGGCTCCGCCATGGTCGCTGG + Exonic
1033489211 7:141825025-141825047 GTGGGCTCCCCCTCTGGCCCAGG + Intergenic
1034324615 7:150219792-150219814 CGGGGCTCTCCCGCGGGCGCTGG - Intergenic
1034522734 7:151632618-151632640 GTGGGCTCCGCGGCGCGGGGAGG + Intronic
1034768579 7:153749439-153749461 CGGGGCTCTCCCGCGGGCGCTGG + Intergenic
1034911585 7:155002718-155002740 GTCGGGTCCGCCGAGGCCGCTGG - Intronic
1035004428 7:155644647-155644669 GGGTGCACCGCGGCGGGCGCGGG + Intronic
1036770406 8:11574989-11575011 GAGGGCTCCGCGGCGGGCACAGG - Intergenic
1036773661 8:11595409-11595431 GTGGGCTCAGCAGCCGGCCCTGG + Intergenic
1037828992 8:22177245-22177267 GTGGGCAGCGCTGCGGGCCCAGG - Intronic
1038020774 8:23550505-23550527 GTGGCCTCCGCCAAGGGCGTGGG + Intronic
1040650968 8:49448446-49448468 GTAGGCTCCACCTCGGGGGCAGG + Intergenic
1042962692 8:74320841-74320863 GTGGGCTCTGCCCCGGCTGCGGG - Intronic
1044692906 8:94896283-94896305 GCGGGCTCCGCAGGGCGCGCTGG - Intronic
1049311445 8:141935908-141935930 GTGGGATGCTCCGCGGGGGCGGG + Intergenic
1049774421 8:144397894-144397916 GTGGGCTCAGCGGCGGGCAAGGG + Intronic
1050090716 9:2015226-2015248 CTCGCCTCCTCCGCGGGCGCCGG - Exonic
1051174010 9:14346111-14346133 GGGGGGCGCGCCGCGGGCGCGGG + Intronic
1053230128 9:36400981-36401003 CTGGCCTCCGCTGCGCGCGCAGG + Intronic
1054285393 9:63163640-63163662 GTGGGCTCCCCAGCGGCCGGTGG - Intergenic
1054389427 9:64601383-64601405 GTGGGCTCCCCAGCGGCCGGCGG + Intergenic
1057155742 9:92837438-92837460 GTGGTCTCCGCTGGGGCCGCTGG + Intergenic
1059483635 9:114611310-114611332 CTCCGCTCCGCCGCGGGCCCGGG + Exonic
1061489799 9:130938672-130938694 GTGGGCGCGGGCGCGGGCGCGGG + Exonic
1062363754 9:136199268-136199290 GCGGGTTCTGCCGCGGGGGCGGG + Intronic
1062507702 9:136886565-136886587 GCGGGGTCGGGCGCGGGCGCGGG + Intronic
1189025350 X:37388378-37388400 GTGGGCTCTGCCCCTGGAGCAGG + Intronic
1190274566 X:48891688-48891710 GTGGGGCCCGCCGCGGGCTCAGG + Intergenic
1196442356 X:115728423-115728445 GCAGGCTCCGCCGCGGGGTCGGG - Intergenic
1196443201 X:115732481-115732503 GCAGGCTCCGCCGCGGGGTCGGG + Intergenic
1196443859 X:115735449-115735471 GCAGGCTCCGCCGCGGGGTCGGG + Intergenic
1196445522 X:115844396-115844418 GCAGGCTCCGCCGCGGGGTCGGG + Intergenic
1196446193 X:115847377-115847399 GCAGGCTCCGCCGCGGGGTCGGG + Intergenic
1196446864 X:115850358-115850380 GCAGGCTCCGCCGCGGGGTCGGG + Intergenic
1196447532 X:115853341-115853363 GCAGGCTCCGCCGCGGGGTCGGG + Intergenic
1196448203 X:115856320-115856342 GCAGGCTCCGCCGCGGGGTCGGG + Intergenic
1196448872 X:115859311-115859333 GCAGGCTCCGCCGCGGGGTCGGG + Intergenic
1196449543 X:115862302-115862324 GCAGGCTCCGCCGCGGGGTCGGG + Intergenic
1196450212 X:115865285-115865307 GCAGGCTCCGCCGCGGGGTCGGG + Intergenic
1196450882 X:115868270-115868292 GCAGGCTCCGCCGCGGGGTCGGG + Intergenic
1196451553 X:115871249-115871271 GCAGGCTCCGCCGCGGGGTCGGG + Intergenic
1196452224 X:115874236-115874258 GCAGGCTCCGCCGCGGGGTCGGG + Intergenic
1196452894 X:115877205-115877227 GCAGGCTCCGCCGCGGGGTCGGG + Intergenic
1196453564 X:115880198-115880220 GCAGGCTCCGCCGCGGGGTCGGG + Intergenic
1196454233 X:115883207-115883229 GCAGGCTCCGCCGCGGGGTCGGG + Intergenic
1196455314 X:115888279-115888301 GCAGGCTCCGCCGCGGGGTCGGG + Intergenic
1199237776 X:145510589-145510611 GTGGGCTCTGCCACTGGAGCAGG - Intergenic
1199772659 X:150984192-150984214 GGGGGCGCCGCTGCGGGCCCTGG + Intronic
1200068905 X:153518191-153518213 GTGGGCGCAGCCGGGGGCGCGGG + Intronic
1200100915 X:153688770-153688792 GTGGGCTTCGCCGTGGGCTTGGG + Exonic