ID: 1024578714

View in Genome Browser
Species Human (GRCh38)
Location 7:50784582-50784604
Sequence GAAGCAGCTGTTCCTGGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 258}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024578705_1024578714 18 Left 1024578705 7:50784541-50784563 CCACACTCCCCTCTATTACAAAA 0: 1
1: 0
2: 0
3: 19
4: 195
Right 1024578714 7:50784582-50784604 GAAGCAGCTGTTCCTGGATGTGG 0: 1
1: 0
2: 4
3: 30
4: 258
1024578708_1024578714 9 Left 1024578708 7:50784550-50784572 CCTCTATTACAAAATGCCAGAGG 0: 1
1: 0
2: 1
3: 21
4: 199
Right 1024578714 7:50784582-50784604 GAAGCAGCTGTTCCTGGATGTGG 0: 1
1: 0
2: 4
3: 30
4: 258
1024578707_1024578714 10 Left 1024578707 7:50784549-50784571 CCCTCTATTACAAAATGCCAGAG 0: 1
1: 0
2: 1
3: 11
4: 187
Right 1024578714 7:50784582-50784604 GAAGCAGCTGTTCCTGGATGTGG 0: 1
1: 0
2: 4
3: 30
4: 258
1024578710_1024578714 -7 Left 1024578710 7:50784566-50784588 CCAGAGGTCCCAGTTCGAAGCAG 0: 1
1: 0
2: 0
3: 7
4: 106
Right 1024578714 7:50784582-50784604 GAAGCAGCTGTTCCTGGATGTGG 0: 1
1: 0
2: 4
3: 30
4: 258
1024578706_1024578714 11 Left 1024578706 7:50784548-50784570 CCCCTCTATTACAAAATGCCAGA 0: 1
1: 0
2: 0
3: 12
4: 177
Right 1024578714 7:50784582-50784604 GAAGCAGCTGTTCCTGGATGTGG 0: 1
1: 0
2: 4
3: 30
4: 258
1024578704_1024578714 22 Left 1024578704 7:50784537-50784559 CCTGCCACACTCCCCTCTATTAC 0: 1
1: 0
2: 2
3: 11
4: 215
Right 1024578714 7:50784582-50784604 GAAGCAGCTGTTCCTGGATGTGG 0: 1
1: 0
2: 4
3: 30
4: 258
1024578703_1024578714 23 Left 1024578703 7:50784536-50784558 CCCTGCCACACTCCCCTCTATTA 0: 1
1: 0
2: 2
3: 8
4: 365
Right 1024578714 7:50784582-50784604 GAAGCAGCTGTTCCTGGATGTGG 0: 1
1: 0
2: 4
3: 30
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024578714 Original CRISPR GAAGCAGCTGTTCCTGGATG TGG Intronic
900383662 1:2398998-2399020 GATGAAGCTGCTCCTGGGTGGGG + Intronic
901850339 1:12011038-12011060 GAAGCAGCTGTCCCCAGGTGGGG - Intronic
901936240 1:12629181-12629203 GATGTAGCTGGTCCTGCATGTGG + Intergenic
901974340 1:12932422-12932444 AAAGGACCTGTGCCTGGATGTGG - Intronic
902010834 1:13269346-13269368 AAAGGACCTGTGCCTGGATGTGG + Intergenic
902333278 1:15741326-15741348 GTAGCAGGTGTTCCTGGGAGCGG - Exonic
902925237 1:19691621-19691643 GCAGCTGCTGATCCTGAATGGGG + Intronic
902960832 1:19961852-19961874 GATGCACCTGTGCCTGGATTGGG + Intergenic
904560957 1:31397099-31397121 GAAGCAGCTGTGCCTAGATCTGG + Intergenic
905202591 1:36324060-36324082 GAAGCAGCTTTGCCTGGAAGGGG - Exonic
905202932 1:36326056-36326078 GAGGCAGCTGTGCCAGGATCTGG + Intronic
908669670 1:66532964-66532986 GAGGCAGTTGTGCCTGGTTGTGG - Intergenic
909140613 1:71859870-71859892 AAAGTAACTGTTCCTGAATGAGG + Intronic
909767102 1:79369945-79369967 GAAGCAGCAATTCCTGGAGCTGG + Intergenic
913974863 1:143447379-143447401 GATGCAGATGTTAATGGATGGGG - Intergenic
914069255 1:144272996-144273018 GATGCAGATGTTAATGGATGGGG - Intergenic
914109900 1:144693358-144693380 GATGCAGATGTTAATGGATGGGG + Intergenic
914950467 1:152109565-152109587 GAAGCAGCGATACCGGGATGAGG - Exonic
916084840 1:161260936-161260958 GAAGCAGCTGTCTCTGAATCAGG + Intronic
916274149 1:162975913-162975935 GAAGCAGCTTATAATGGATGTGG + Intergenic
918362369 1:183772090-183772112 GAAGCAGCTGTCCACCGATGGGG - Intronic
918967128 1:191365451-191365473 GAAACAGCTGCTCCTGGATGTGG + Intergenic
922239426 1:223745960-223745982 GAAGCAGCTGTGCGGAGATGGGG - Intronic
1062966370 10:1610562-1610584 TCAGCAGCTGGTGCTGGATGAGG - Intronic
1063111595 10:3042800-3042822 GAAGCAGCTCTTCCTGGCAAGGG + Intergenic
1063341694 10:5271364-5271386 AAAGCAGCTGGGCCTGAATGGGG - Intergenic
1063612503 10:7574957-7574979 AAAGCCACTTTTCCTGGATGTGG + Intronic
1063691446 10:8291052-8291074 GAAGCAGATGTACTTGGCTGGGG + Intergenic
1064331289 10:14396672-14396694 CAAGCAGGTGTTCCTGGAAGGGG - Intronic
1064703279 10:18044496-18044518 GATGCTGCTTTTGCTGGATGGGG + Intergenic
1064749199 10:18509197-18509219 GGAGCAGTTGTGCCTGGAGGTGG - Intronic
1064979202 10:21149188-21149210 GGGGCAGCTGTTCCTGGAGGGGG + Intronic
1065673647 10:28150557-28150579 TGAGCAGATGTTCCTGGATGTGG - Intronic
1071551469 10:86569369-86569391 GTTGAAGCTGTTCCTGGGTGGGG + Intergenic
1074821535 10:117183047-117183069 GAAGCAGCAGTTCCAGTTTGGGG + Intergenic
1074914156 10:117939503-117939525 GAAGGAGCTACTCCTGGAAGAGG - Intergenic
1075883071 10:125871489-125871511 CAAGTAGCTGTTACTGGAAGGGG - Intronic
1075903263 10:126060548-126060570 GAAGCATTTGCTCCTGGGTGGGG + Intronic
1076514330 10:131034685-131034707 GAAGCAGCTGGTGCTGGCTCTGG - Intergenic
1076560774 10:131361893-131361915 GAGCCAGCTGTTCCGGGATCTGG - Intergenic
1076775415 10:132694052-132694074 GATTCTGCTGTTACTGGATGAGG - Intronic
1076915699 10:133422275-133422297 GAAGCAGCTGTTCCAGGCCTCGG - Exonic
1077043281 11:533911-533933 GAAGCAGGTGGTCATTGATGGGG - Exonic
1077074685 11:695002-695024 AAAGCAGCTGGGCCTGGCTGAGG - Exonic
1077406033 11:2382947-2382969 GGAACAGCTGGTCCTGGAAGGGG + Intronic
1077408264 11:2392146-2392168 GAGGCAGGTGTTCTTGGAAGGGG + Intronic
1078241587 11:9535348-9535370 GAGCCAGCTGTGCCTTGATGGGG + Intergenic
1079935747 11:26614162-26614184 GAAGCAGTTGTTTCTGGGGGTGG + Intronic
1081869420 11:46376580-46376602 GAAGCAGCTGTGGCTGGAGCAGG - Intronic
1081984213 11:47289870-47289892 GAACCAGCAGTTCCTGAAGGAGG + Exonic
1082267352 11:50133622-50133644 GGAGCAGCTGTTCCTGAATCAGG - Intergenic
1082288735 11:50344946-50344968 GGAGCAGCTGTTCCTGAATCAGG + Intergenic
1083889483 11:65588832-65588854 GCAGCAGCCGCTCCTGGGTGTGG + Intronic
1084777991 11:71389716-71389738 GACTCAGCTGCTCCTGGTTGAGG + Intergenic
1084799902 11:71536666-71536688 GAAGCAGTTGGTCATGGTTGGGG + Intronic
1085196066 11:74672570-74672592 TAAGCAGTAGTTCCTGGGTGAGG - Intergenic
1085300820 11:75457234-75457256 GAAGCAGAGGCTCCTGGAAGAGG + Intronic
1085341103 11:75732191-75732213 GAAGCAGCAGTTCCTGAACCAGG + Intronic
1085614762 11:77988454-77988476 GAAGCTTATGTTCCTGCATGGGG + Intronic
1085854734 11:80163260-80163282 GAAGAAGCTGGTAATGGATGGGG - Intergenic
1085868302 11:80320923-80320945 GAAGCAGCTACTCCTGGGGGAGG - Intergenic
1087164547 11:94988536-94988558 GAAGGATCTGTTCCTGGAGAAGG + Intronic
1089202457 11:116732659-116732681 GGAGCAGCTATCCCTGGTTGAGG - Intergenic
1090310403 11:125731612-125731634 GAAGAAGCTTTTCTGGGATGGGG + Intergenic
1090577830 11:128127551-128127573 CAAGCAGCTGTGCGTGCATGTGG + Intergenic
1091928977 12:4379427-4379449 GTGGTAGCTGTTCCTGGCTGTGG + Exonic
1092191851 12:6526928-6526950 GAACCTGCTGTCCCTGGCTGGGG + Exonic
1093710240 12:22321436-22321458 GAAGCAGCAGCTCCTAGAGGAGG + Intronic
1095948312 12:47766474-47766496 GAGGGAGCTGTTGCTGGATGGGG - Intronic
1096188624 12:49600151-49600173 GAGGCAGCTGTGGCTGGAGGAGG - Exonic
1096693227 12:53333709-53333731 GAAGCAGCTGCTGCTTGATGGGG - Intronic
1100055246 12:90501226-90501248 GAACCAGCTTTTCCAGGAGGAGG + Intergenic
1100241652 12:92715604-92715626 CAAGCAGCTGTTCAAGGAAGTGG - Intergenic
1100859887 12:98793778-98793800 GAAGCATCTGTTACTGTAAGAGG - Intronic
1102023466 12:109699724-109699746 GAAGCAGTGGTTCCTGGGGGAGG + Intergenic
1102170994 12:110842413-110842435 GAAGCACCTGGTTCTGGAAGGGG + Intergenic
1102771986 12:115485981-115486003 CAAGCAGATATTTCTGGATGTGG - Intergenic
1102961600 12:117097050-117097072 GAGGCTGCTGTTCCTGGAGGGGG - Intronic
1103013085 12:117472900-117472922 GAATTGGCTGTTCCTGGAAGGGG - Intronic
1104443930 12:128818533-128818555 GAAGCAGCCGCACCTGGAGGGGG + Intronic
1104469648 12:129019208-129019230 GAGGCCTCTGTTCCTGGCTGTGG - Intergenic
1105505910 13:21009695-21009717 GTAGCAGCTGTTCCTCCATCTGG - Intronic
1106242917 13:27924705-27924727 GCAGGAGCTGCTCCTGGCTGAGG + Exonic
1106603692 13:31208800-31208822 CAAACAGCTGTTCCTGGCTCAGG + Intronic
1108519802 13:51236125-51236147 GCAGCAGCTGTGCCTAGTTGGGG - Intronic
1111227579 13:85294559-85294581 GCAGCAGCTGCTGCTGGAAGGGG + Intergenic
1111876530 13:93904072-93904094 CAAACAGCTGTTACAGGATGAGG + Intronic
1113821712 13:113219016-113219038 GAAGGATCTGTGCCTGGACGTGG - Exonic
1114271499 14:21103065-21103087 GAAGCAGTTGTTTCTGTCTGGGG + Intronic
1115304848 14:31923383-31923405 TAAGCATCTGTTCTTGTATGGGG - Intergenic
1117117868 14:52534993-52535015 GAAACAGCTGGCCCTAGATGTGG - Intronic
1118842289 14:69522318-69522340 GAAGCAGCAGTTCGAGGAGGTGG + Exonic
1119277586 14:73373160-73373182 GAAACAGCTGGGCCTGGGTGGGG - Intronic
1119466483 14:74862799-74862821 GAATCTGATTTTCCTGGATGTGG + Intronic
1119467701 14:74872424-74872446 AAAGCAGCTGTTTCAGGATAAGG - Intergenic
1119543515 14:75455933-75455955 AAAGCAGCAGAGCCTGGATGCGG - Intronic
1121545123 14:94757597-94757619 GTAGCTGCTTTTCCTGGATATGG - Intergenic
1123105477 14:105839322-105839344 GAAGCAGCTGCTGCTGCAGGGGG + Intergenic
1126451397 15:48812625-48812647 GAAGCAGTTGTTTGTGCATGGGG - Intergenic
1127682858 15:61314621-61314643 GAGGGAGCTGTTCTTGGAGGAGG - Intergenic
1128150770 15:65362338-65362360 AAAGCAGCTTCTCCTGGAAGTGG + Intronic
1129790594 15:78338347-78338369 TAAGTAGCAGGTCCTGGATGTGG - Intergenic
1132338413 15:101063373-101063395 GGAGGGGCTGTTCCTGGAGGAGG - Intronic
1132727656 16:1345763-1345785 GGAGCTGCTGTGCCTGGAGGAGG - Exonic
1132751887 16:1461425-1461447 GAACCAGCTGTTCCTGGAGGAGG - Exonic
1133220730 16:4318109-4318131 AAAGCAGCGGTGCCTGGAAGTGG - Intronic
1134057987 16:11182264-11182286 CAAGCAGCTGCGCCGGGATGAGG - Intergenic
1135125354 16:19805026-19805048 GCTGCAGCTGTTCCAGGAAGGGG + Intronic
1137499262 16:48997846-48997868 GAAGCAGCTGGCCCAGGCTGGGG - Intergenic
1138163752 16:54780485-54780507 GCTGCAGCTGTCCCAGGATGGGG + Intergenic
1138818387 16:60229021-60229043 GGAGCTGCTGTCCCTGAATGAGG - Intergenic
1139483089 16:67241413-67241435 GATGCGGCTGTGCCTGAATGGGG - Intronic
1141461817 16:84182295-84182317 GGAGCAGCTGCTTCTGGATGAGG - Exonic
1142012090 16:87720680-87720702 GCAGCAGCTCTGCCTGGAGGGGG - Intronic
1142121738 16:88389909-88389931 GAAGCACCTGGCCCTGCATGTGG - Intergenic
1144026863 17:11285143-11285165 GAAGTAAGTCTTCCTGGATGAGG + Intronic
1144662709 17:17081636-17081658 GCAGCAGCAGTCCCTGGATCTGG + Intronic
1146737134 17:35248101-35248123 GAAGCAGTTTCTCCTAGATGAGG - Intronic
1148679501 17:49465629-49465651 GAGGCAGATGTTTCTAGATGAGG + Intronic
1149154466 17:53609859-53609881 TAAGCTTCTGTACCTGGATGGGG + Intergenic
1149303302 17:55325500-55325522 GAATCAGTAGTTCTTGGATGGGG + Intergenic
1151427170 17:74038531-74038553 GCAGCAGCAGTTGCTGGAGGAGG - Intergenic
1152928050 17:83096872-83096894 GAAGCAGGTGTTTCTGGGCGAGG + Intergenic
1154177382 18:12094279-12094301 GAAGCCCCTGTTCCTGGTTTCGG + Intronic
1155126591 18:22883416-22883438 GAAGCAACTCTTCCTGAGTGAGG - Intronic
1156479869 18:37429599-37429621 GAAGAAGCAGTCCCTGCATGAGG - Intronic
1157280618 18:46344466-46344488 GAAGCAGGTGTTCTAGGAGGTGG - Intronic
1159358155 18:67363803-67363825 CAAGCTGCTGTTCATGGCTGTGG + Intergenic
1159891146 18:73954470-73954492 GAAGCAGCTGCCCCTGGGTGTGG + Intergenic
1159921669 18:74232271-74232293 TAAGCACCTGTGCCTGGCTGAGG - Intergenic
1160494401 18:79363641-79363663 TAAACAGATGTTCCTGGATTCGG + Intronic
1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG + Exonic
1160810445 19:1010817-1010839 GAAGCAGCATCTCCTGGATGCGG + Exonic
1161233899 19:3188694-3188716 GACGCAGCTTTCCCTGTATGTGG + Intronic
1162869248 19:13573120-13573142 GAAGAAGCTGATCAAGGATGCGG - Intronic
1164465974 19:28488027-28488049 GCAGCATCTGTCCCTGGAAGGGG - Intergenic
1164682945 19:30148009-30148031 GATGCAGCTGTCCCTGGGTGTGG + Intergenic
1164683225 19:30149831-30149853 AAAGCAGATGGTCCTGGATTGGG - Intergenic
1164683565 19:30151920-30151942 GATGCAGCTGTCCCTGAGTGTGG + Intergenic
1164745652 19:30610803-30610825 GAAGCAGCTCTCTCTGGGTGTGG - Intronic
1166730580 19:45057036-45057058 GAGGCAGCTGCTCCAGGATAAGG - Intronic
1166897675 19:46034074-46034096 GCAGCAGCTGTTGCTTGATTCGG - Intergenic
1167694456 19:51006650-51006672 GGAGCAGCTGTTCCGGGTTACGG - Exonic
1168348176 19:55660863-55660885 GGAGCAGCAGTTACTGGGTGGGG + Intronic
925036374 2:690006-690028 GAAGCTGCAGTGCCTGGCTGAGG + Intergenic
925267684 2:2578250-2578272 GAAGAGGCTGTGCCTGGAGGTGG - Intergenic
928030223 2:27771714-27771736 GAAGCAGTTGTTGTTGGTTGGGG + Exonic
930140846 2:47950042-47950064 TAAGCAGCTGAGCCAGGATGAGG + Intergenic
932410659 2:71545459-71545481 GAACAATCTGTTCCGGGATGTGG + Intronic
934179565 2:89608348-89608370 GATGCAGATGTTAATGGATGGGG - Intergenic
934289857 2:91682616-91682638 GATGCAGATGTTAATGGATGGGG - Intergenic
935176639 2:100654714-100654736 AAAGAAGCTGTGGCTGGATGCGG - Intergenic
938405182 2:131028605-131028627 GAACCAGTTTTGCCTGGATGAGG - Intronic
943738221 2:191381023-191381045 GAGGGATCTGTCCCTGGATGGGG + Intronic
944285885 2:197949400-197949422 GAATCACTTGTCCCTGGATGGGG - Intronic
944540005 2:200745728-200745750 GAATGAGCTGTTGCTGGATGAGG + Intergenic
945772666 2:214063686-214063708 GAGGAAGCAGTTCCTGGAAGAGG - Intronic
947017183 2:225634031-225634053 GAAGCTGCTGTTCCTGGACAAGG + Intronic
947099352 2:226603048-226603070 GAATCAGTTGTTCCTGGTTCTGG + Intergenic
948281717 2:236752243-236752265 GAAGGGGCTGTTCCAGGATTTGG + Intergenic
948902719 2:240964496-240964518 GAAGCTGCTCATCCTGGAGGAGG + Intronic
1173846041 20:46189377-46189399 GAGGCGCCTGTTCCTGGCTGTGG - Intronic
1174505549 20:51015334-51015356 GAGGAAGCTGTTCCTGGCTGTGG + Intronic
1174765528 20:53250055-53250077 GAATCAGCTGTTCCAGGAATGGG + Intronic
1175538756 20:59734911-59734933 GAAGCAACTTTTCCTGCTTGAGG - Intronic
1175585097 20:60132903-60132925 GAAGCACCTGTACCTGGATCAGG + Intergenic
1176061517 20:63174840-63174862 GAGCCAGCTGTTCCCAGATGTGG + Intergenic
1176070309 20:63222782-63222804 GGAGCACCTGTCCCAGGATGAGG + Intergenic
1176135808 20:63521524-63521546 GCAGGAGCTGTTGCTGGAAGTGG - Exonic
1176423208 21:6532708-6532730 GGAGCAGCTGCACCTGGAGGTGG - Intergenic
1177903634 21:26948429-26948451 GAAGCATCTGTTTCTTAATGAGG + Intronic
1179698701 21:43141024-43141046 GGAGCAGCTGCACCTGGAGGTGG - Intergenic
1180870576 22:19144520-19144542 CAAGCAGCGGGTCCTGGACGAGG - Exonic
1181270660 22:21656870-21656892 GAAGAAGCTGTGCGTGAATGTGG + Intronic
1184138068 22:42561213-42561235 GAAGCAGCTCTCCCAGGGTGAGG + Intronic
1184667502 22:45996603-45996625 CAAGCAGCCCTCCCTGGATGGGG - Intergenic
1185333748 22:50262550-50262572 GGAGCATCTGGTCCAGGATGGGG - Intergenic
950537016 3:13584602-13584624 GAGGCAACTGTGCCTGTATGGGG + Intronic
953917124 3:46927217-46927239 GAGGCAGGTGTTCAAGGATGGGG - Intronic
954722206 3:52574456-52574478 GAACCAGCTGTTGCCGGCTGGGG + Intronic
954744176 3:52777761-52777783 TAGGCAGCTGAACCTGGATGAGG + Intronic
956760549 3:72439730-72439752 GAAACAGCTGTTCAAGTATGTGG + Intronic
956909106 3:73798746-73798768 GGAGCAGCTGTTCCTAAATCGGG - Intergenic
959853086 3:111113894-111113916 GAATCACCTGTACCTGGAGGCGG + Intronic
962075409 3:132076599-132076621 GAAGCAGTTGTACTTGGATTGGG - Intronic
962318150 3:134371370-134371392 AGCGCAGCTGCTCCTGGATGAGG + Exonic
963847928 3:150178753-150178775 GAAGCGCCTGATCCTGGGTGAGG + Intergenic
964812722 3:160683174-160683196 GAGGCAGGTGTGGCTGGATGGGG - Intergenic
967279925 3:187812060-187812082 CAACAAGCTGTTACTGGATGAGG + Intergenic
967574735 3:191076886-191076908 GAATCAGCTGTTCCAGCCTGTGG + Intergenic
967730726 3:192904548-192904570 GATGCAGCTGCTGCTGGTTGAGG - Intronic
967929419 3:194679964-194679986 CAAGCAGCTCTTCCTAGAGGGGG + Intergenic
969073124 4:4555811-4555833 GAAGAAGAATTTCCTGGATGTGG + Intergenic
970079748 4:12268656-12268678 TAAACAGATATTCCTGGATGTGG + Intergenic
971004371 4:22357115-22357137 GAAGCATGTGTTCCTGGGCGGGG + Intronic
973598127 4:52513375-52513397 GAAGCTGCTTTGCCTGGGTGAGG - Intergenic
974373919 4:61051760-61051782 GAAGCAGCTGTGCTTGGGTGAGG - Intergenic
974882096 4:67772291-67772313 GAAGCAGTGGTTACTGCATGGGG - Intergenic
975815222 4:78210139-78210161 GAAGCAGCTGTTCCAGGAAGAGG - Intronic
978531820 4:109722285-109722307 GAACCTGCTCTTCCTGTATGTGG + Intronic
978928531 4:114281562-114281584 ACAGCAGCTGTACCTGGATATGG + Intergenic
981257018 4:142673827-142673849 GAAAGAGCTATTCCTAGATGCGG + Intronic
981693583 4:147536490-147536512 GGGGAAGCTGTTCATGGATGAGG + Intronic
984049624 4:174847918-174847940 GAAACAGATGTTCCTGCATTAGG + Intronic
984709055 4:182869781-182869803 GAAGCAGATGTCCCTGGACCCGG - Intergenic
985162754 4:187061541-187061563 GAAGCAGCACTTCCTGAATGTGG + Intergenic
985506491 5:284568-284590 GAAGCTGATGTTCCGGTATGAGG + Intronic
985873451 5:2577391-2577413 GAAGGGGCTGTTCCTGGAAGCGG - Intergenic
986858776 5:11903619-11903641 GAAGCCGCTGTGCCTGGAAGGGG - Intronic
988369559 5:30348401-30348423 GAAGCCACAGTTCCTGCATGTGG + Intergenic
990252925 5:53935284-53935306 GCAGCTACTGCTCCTGGATGAGG - Intronic
991155491 5:63429919-63429941 TAAGCAACTGTTCCTGCCTGTGG + Intergenic
991605524 5:68396806-68396828 GAAGAGGCTGCTCCTGGATGTGG + Intergenic
991997567 5:72403133-72403155 GATGCAGTTGTTCCTAAATGTGG - Intergenic
994886133 5:105564126-105564148 GAAGTAACTCTCCCTGGATGTGG - Intergenic
995321573 5:110840492-110840514 AAAGCAGCAGTTTCTGGGTGAGG - Intergenic
998035801 5:138914792-138914814 GAAACTGCTGGACCTGGATGAGG - Intronic
998649306 5:144100102-144100124 GAAGCATCTGTTTCTGCAGGTGG + Intergenic
998895990 5:146800717-146800739 TAATCAGCTGTGCTTGGATGGGG + Intronic
999865929 5:155700526-155700548 GAAGCTTCTGTTCCTGGTTCTGG + Intergenic
1000412894 5:160952332-160952354 CAAGCAGCTGTTCATTTATGAGG + Intergenic
1001338038 5:170817257-170817279 GAAGCAGTGGTTCCTGAATCCGG + Intergenic
1002293625 5:178215831-178215853 GAAGCAGCTTTTCCTGGGTGGGG - Intronic
1002708922 5:181182415-181182437 GAAGGTGCAGTTCCTGGAGGAGG + Intergenic
1003421059 6:5959048-5959070 GAAGCAGCTCTCCTTGGAAGTGG - Intergenic
1003644522 6:7903756-7903778 GAAGAAGCTGTTTCTGAAGGAGG - Intronic
1006052082 6:31352963-31352985 GAGGCAGGTGATCCAGGATGTGG - Intronic
1006504787 6:34481924-34481946 GAAGTAGCTGTTAATGGATATGG - Intronic
1007207587 6:40165100-40165122 TAAGCAGTTTTTCCTGGAAGGGG + Intergenic
1010960791 6:82143482-82143504 GACTCAGCTTTTCCTGGATTAGG - Intergenic
1011166433 6:84452518-84452540 GGAGCAGCTGTTGAAGGATGGGG + Intergenic
1011723346 6:90182427-90182449 GAAGCAGTTCTGCCTGGATGAGG - Intronic
1012946030 6:105466731-105466753 GAAGCTGCCAGTCCTGGATGGGG + Intergenic
1013073631 6:106751588-106751610 GCTGCAGCTGCTCCTGGTTGGGG - Intergenic
1013220618 6:108074486-108074508 GGAGCAGCAGTTGCTGGAGGTGG - Exonic
1013646471 6:112146482-112146504 GAATCAGCAGTTCCTGGAGTGGG + Intronic
1015825712 6:137309375-137309397 GAGGCAGCAGTTCCTGTTTGAGG + Intergenic
1017681785 6:156871741-156871763 GAAGCCCCTGTTCCTGCAGGAGG - Intronic
1017690404 6:156958229-156958251 GAAAAAGCTGTTCCTAGGTGTGG - Intronic
1019292090 7:255843-255865 GAAGCAGATGTTGTTGGCTGGGG - Exonic
1020068706 7:5211144-5211166 GATGCACATGTTCCTGGCTGAGG - Intronic
1021413453 7:20354768-20354790 GAAGCAGAAGTTTCTGAATGGGG - Intronic
1022026250 7:26450416-26450438 GAAGTAACTGTTCTGGGATGGGG - Intergenic
1022259654 7:28691876-28691898 GAAGCAGCTGTGGCTGGGCGTGG + Intronic
1024578714 7:50784582-50784604 GAAGCAGCTGTTCCTGGATGTGG + Intronic
1026969547 7:74459625-74459647 GAAGCAGGTGGTCCTGAAAGAGG - Intronic
1027522035 7:79221305-79221327 ATGGCAGCTCTTCCTGGATGTGG - Intronic
1030611729 7:111697366-111697388 GGAGCTGCTGTGCCTGGCTGAGG + Intergenic
1030645243 7:112053868-112053890 ATAGGAGCTGTTCCTGGAAGGGG + Intronic
1031165089 7:118218095-118218117 GCAGCAGCTTTTCCTGGAGGAGG - Intronic
1032390294 7:131551551-131551573 GAAGCAGCACTTCCTGGAATAGG + Intronic
1032524380 7:132568633-132568655 GAAGAAGCTGCTCCTGGCAGTGG - Intronic
1035040083 7:155920861-155920883 GAAGGAGCTGATGCTGGGTGGGG + Intergenic
1035460718 7:159036937-159036959 GTAGCTGCTGTTACCGGATGAGG - Intronic
1035785990 8:2261642-2261664 GAATGAGCTGTTCCAGAATGGGG + Intergenic
1035785999 8:2261714-2261736 TGAGGAGCTGTTCCAGGATGAGG + Intergenic
1035806808 8:2460002-2460024 TGAGGAGCTGTTCCAGGATGAGG - Intergenic
1035806817 8:2460074-2460096 GAATGAGCTGTTCCAGAATGGGG - Intergenic
1036792047 8:11727372-11727394 TAAGCAGCTGTTCCTGGTGAAGG + Intronic
1037934167 8:22903509-22903531 GAGGCAGCAGTTCCTGAATGGGG + Intronic
1038907866 8:31927341-31927363 GAATCAGTAGTTCTTGGATGGGG + Intronic
1039986285 8:42451119-42451141 GAAGCAGCTGCAACTGGAGGAGG + Intronic
1040466193 8:47697574-47697596 CACGCAGCTGCTCCTGGAGGCGG - Intronic
1043045136 8:75313793-75313815 GAAGCAGCTGCTGCTGCCTGAGG + Intergenic
1044611844 8:94099349-94099371 GAAGCACCTCTTCCAGGAGGAGG + Intergenic
1047432774 8:124807054-124807076 GAAGCAGCAGTCACTGGATGTGG - Intergenic
1047898075 8:129388906-129388928 GACACAGCAGTTGCTGGATGGGG + Intergenic
1048878607 8:138855790-138855812 GAAGCAGCTCTGCCTGGGTGTGG - Intronic
1049681818 8:143922251-143922273 GGAGCAGCTCTTCCAGGACGAGG - Exonic
1050425775 9:5511231-5511253 GAGGCAGCTGTTGGTGGAGGGGG + Intronic
1050480882 9:6085818-6085840 GAAGCAGATGTTTCAGGATAAGG + Intergenic
1051104971 9:13569070-13569092 GAAGCAGATGCTCCTGGCTTCGG + Intergenic
1052201801 9:25791329-25791351 AAAGCAGATGTTTCTAGATGAGG + Intergenic
1052956458 9:34256381-34256403 GGAGCAGCTGGTCCAGGATGGGG - Exonic
1053025505 9:34725436-34725458 GAATCAACTGTTTCTGGATGTGG + Exonic
1053037035 9:34834498-34834520 GAATCGACTGTTTCTGGATGTGG + Intergenic
1053323119 9:37118410-37118432 GTCCCAGCTGTTCCTGGCTGAGG - Intergenic
1057353320 9:94317654-94317676 GAAGCAGATGCTCCTTGCTGTGG - Intergenic
1057654431 9:96939938-96939960 GAAGCAGATGCTCCTTGCTGTGG + Intronic
1060158093 9:121334279-121334301 CAAGCAGCTGCTACAGGATGTGG - Intergenic
1060959303 9:127668113-127668135 GAAGGAGGTGCTCCTGGACGAGG + Exonic
1061660324 9:132125837-132125859 GCAGCAGCTGTTTCTGCATCAGG + Intergenic
1062491259 9:136806179-136806201 GAAGCAGCTGGAGCTGGAGGAGG + Exonic
1187225044 X:17367627-17367649 GAAGCAGCAGCTCCTGTATCAGG + Intergenic
1188582819 X:31735884-31735906 CAAGAAGCTGGTCCTGGTTGAGG - Intronic
1189573347 X:42323109-42323131 GCAGCAGCTCTTCCTGAGTGAGG + Intergenic
1193064418 X:77244253-77244275 GAAGAAACTGTTCCTGGGGGAGG + Intergenic
1196192793 X:112812118-112812140 GAAGAAGTTATTCCTGGTTGGGG + Intronic
1200181207 X:154151706-154151728 GGAGCTGCTGCTGCTGGATGTGG - Intronic
1200186852 X:154188820-154188842 GGAGCTGCTGCTGCTGGATGTGG - Intergenic
1200192503 X:154225958-154225980 GGAGCTGCTGCTGCTGGATGTGG - Intronic
1200198258 X:154263762-154263784 GGAGCTGCTGCTGCTGGATGTGG - Intronic
1200828690 Y:7668853-7668875 GAAGCAGCTGTTAACAGATGGGG + Intergenic