ID: 1024580392

View in Genome Browser
Species Human (GRCh38)
Location 7:50796200-50796222
Sequence CCGCCTGCCCACCCCTGCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024580387_1024580392 13 Left 1024580387 7:50796164-50796186 CCCATGTGGACATGCGAGCACAT No data
Right 1024580392 7:50796200-50796222 CCGCCTGCCCACCCCTGCAAGGG No data
1024580385_1024580392 22 Left 1024580385 7:50796155-50796177 CCCATGCGGCCCATGTGGACATG No data
Right 1024580392 7:50796200-50796222 CCGCCTGCCCACCCCTGCAAGGG No data
1024580388_1024580392 12 Left 1024580388 7:50796165-50796187 CCATGTGGACATGCGAGCACATG No data
Right 1024580392 7:50796200-50796222 CCGCCTGCCCACCCCTGCAAGGG No data
1024580386_1024580392 21 Left 1024580386 7:50796156-50796178 CCATGCGGCCCATGTGGACATGC No data
Right 1024580392 7:50796200-50796222 CCGCCTGCCCACCCCTGCAAGGG No data
1024580384_1024580392 26 Left 1024580384 7:50796151-50796173 CCATCCCATGCGGCCCATGTGGA No data
Right 1024580392 7:50796200-50796222 CCGCCTGCCCACCCCTGCAAGGG No data
1024580382_1024580392 29 Left 1024580382 7:50796148-50796170 CCACCATCCCATGCGGCCCATGT No data
Right 1024580392 7:50796200-50796222 CCGCCTGCCCACCCCTGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024580392 Original CRISPR CCGCCTGCCCACCCCTGCAA GGG Intergenic
No off target data available for this crispr