ID: 1024581602

View in Genome Browser
Species Human (GRCh38)
Location 7:50805272-50805294
Sequence AGCCTGATGAACCATGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024581602_1024581610 7 Left 1024581602 7:50805272-50805294 CCAGGCCCATGGTTCATCAGGCT No data
Right 1024581610 7:50805302-50805324 CCAGGAGAATGGCTTGACCAGGG No data
1024581602_1024581611 11 Left 1024581602 7:50805272-50805294 CCAGGCCCATGGTTCATCAGGCT No data
Right 1024581611 7:50805306-50805328 GAGAATGGCTTGACCAGGGATGG No data
1024581602_1024581608 6 Left 1024581602 7:50805272-50805294 CCAGGCCCATGGTTCATCAGGCT No data
Right 1024581608 7:50805301-50805323 GCCAGGAGAATGGCTTGACCAGG No data
1024581602_1024581606 -4 Left 1024581602 7:50805272-50805294 CCAGGCCCATGGTTCATCAGGCT No data
Right 1024581606 7:50805291-50805313 GGCTCATCCTGCCAGGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024581602 Original CRISPR AGCCTGATGAACCATGGGCC TGG (reversed) Intergenic
No off target data available for this crispr