ID: 1024581642

View in Genome Browser
Species Human (GRCh38)
Location 7:50805480-50805502
Sequence GTCCTTTGAAGGGCTGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024581633_1024581642 -2 Left 1024581633 7:50805459-50805481 CCCACCCTGATATGTTGACAGGT No data
Right 1024581642 7:50805480-50805502 GTCCTTTGAAGGGCTGGGCAGGG No data
1024581630_1024581642 10 Left 1024581630 7:50805447-50805469 CCTGTGCCTGTTCCCACCCTGAT No data
Right 1024581642 7:50805480-50805502 GTCCTTTGAAGGGCTGGGCAGGG No data
1024581635_1024581642 -6 Left 1024581635 7:50805463-50805485 CCCTGATATGTTGACAGGTCCTT No data
Right 1024581642 7:50805480-50805502 GTCCTTTGAAGGGCTGGGCAGGG No data
1024581634_1024581642 -3 Left 1024581634 7:50805460-50805482 CCACCCTGATATGTTGACAGGTC No data
Right 1024581642 7:50805480-50805502 GTCCTTTGAAGGGCTGGGCAGGG No data
1024581631_1024581642 4 Left 1024581631 7:50805453-50805475 CCTGTTCCCACCCTGATATGTTG No data
Right 1024581642 7:50805480-50805502 GTCCTTTGAAGGGCTGGGCAGGG No data
1024581636_1024581642 -7 Left 1024581636 7:50805464-50805486 CCTGATATGTTGACAGGTCCTTT No data
Right 1024581642 7:50805480-50805502 GTCCTTTGAAGGGCTGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024581642 Original CRISPR GTCCTTTGAAGGGCTGGGCA GGG Intergenic
No off target data available for this crispr