ID: 1024582293

View in Genome Browser
Species Human (GRCh38)
Location 7:50809855-50809877
Sequence CCTCCAGGAGGGACACCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024582287_1024582293 -6 Left 1024582287 7:50809838-50809860 CCAGGGCTGGCCTGGAACCTCCA No data
Right 1024582293 7:50809855-50809877 CCTCCAGGAGGGACACCTGCAGG No data
1024582277_1024582293 30 Left 1024582277 7:50809802-50809824 CCCAGGAACCAAGGCTGAGGAAT No data
Right 1024582293 7:50809855-50809877 CCTCCAGGAGGGACACCTGCAGG No data
1024582280_1024582293 22 Left 1024582280 7:50809810-50809832 CCAAGGCTGAGGAATTCTAGGTA No data
Right 1024582293 7:50809855-50809877 CCTCCAGGAGGGACACCTGCAGG No data
1024582278_1024582293 29 Left 1024582278 7:50809803-50809825 CCAGGAACCAAGGCTGAGGAATT No data
Right 1024582293 7:50809855-50809877 CCTCCAGGAGGGACACCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024582293 Original CRISPR CCTCCAGGAGGGACACCTGC AGG Intergenic
No off target data available for this crispr