ID: 1024582294

View in Genome Browser
Species Human (GRCh38)
Location 7:50809856-50809878
Sequence CTCCAGGAGGGACACCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024582287_1024582294 -5 Left 1024582287 7:50809838-50809860 CCAGGGCTGGCCTGGAACCTCCA No data
Right 1024582294 7:50809856-50809878 CTCCAGGAGGGACACCTGCAGGG No data
1024582278_1024582294 30 Left 1024582278 7:50809803-50809825 CCAGGAACCAAGGCTGAGGAATT No data
Right 1024582294 7:50809856-50809878 CTCCAGGAGGGACACCTGCAGGG No data
1024582280_1024582294 23 Left 1024582280 7:50809810-50809832 CCAAGGCTGAGGAATTCTAGGTA No data
Right 1024582294 7:50809856-50809878 CTCCAGGAGGGACACCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024582294 Original CRISPR CTCCAGGAGGGACACCTGCA GGG Intergenic
No off target data available for this crispr