ID: 1024587113

View in Genome Browser
Species Human (GRCh38)
Location 7:50851519-50851541
Sequence ATTGAAGGGTGCGTAGGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024587113_1024587119 20 Left 1024587113 7:50851519-50851541 CCAACTCCTACGCACCCTTCAAT No data
Right 1024587119 7:50851562-50851584 CCAAACACAGACACTCCTTATGG No data
1024587113_1024587117 -6 Left 1024587113 7:50851519-50851541 CCAACTCCTACGCACCCTTCAAT No data
Right 1024587117 7:50851536-50851558 TTCAATGAGTAAGAGTTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024587113 Original CRISPR ATTGAAGGGTGCGTAGGAGT TGG (reversed) Intergenic
No off target data available for this crispr