ID: 1024587114

View in Genome Browser
Species Human (GRCh38)
Location 7:50851525-50851547
Sequence TTACTCATTGAAGGGTGCGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024587114_1024587121 29 Left 1024587114 7:50851525-50851547 CCTACGCACCCTTCAATGAGTAA No data
Right 1024587121 7:50851577-50851599 CCTTATGGAAAACCAAAGAGAGG No data
1024587114_1024587119 14 Left 1024587114 7:50851525-50851547 CCTACGCACCCTTCAATGAGTAA No data
Right 1024587119 7:50851562-50851584 CCAAACACAGACACTCCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024587114 Original CRISPR TTACTCATTGAAGGGTGCGT AGG (reversed) Intergenic
No off target data available for this crispr