ID: 1024587115

View in Genome Browser
Species Human (GRCh38)
Location 7:50851533-50851555
Sequence GACAACTCTTACTCATTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024587115_1024587121 21 Left 1024587115 7:50851533-50851555 CCCTTCAATGAGTAAGAGTTGTC No data
Right 1024587121 7:50851577-50851599 CCTTATGGAAAACCAAAGAGAGG No data
1024587115_1024587119 6 Left 1024587115 7:50851533-50851555 CCCTTCAATGAGTAAGAGTTGTC No data
Right 1024587119 7:50851562-50851584 CCAAACACAGACACTCCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024587115 Original CRISPR GACAACTCTTACTCATTGAA GGG (reversed) Intergenic
No off target data available for this crispr