ID: 1024587119

View in Genome Browser
Species Human (GRCh38)
Location 7:50851562-50851584
Sequence CCAAACACAGACACTCCTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024587114_1024587119 14 Left 1024587114 7:50851525-50851547 CCTACGCACCCTTCAATGAGTAA No data
Right 1024587119 7:50851562-50851584 CCAAACACAGACACTCCTTATGG No data
1024587115_1024587119 6 Left 1024587115 7:50851533-50851555 CCCTTCAATGAGTAAGAGTTGTC No data
Right 1024587119 7:50851562-50851584 CCAAACACAGACACTCCTTATGG No data
1024587112_1024587119 24 Left 1024587112 7:50851515-50851537 CCTGCCAACTCCTACGCACCCTT No data
Right 1024587119 7:50851562-50851584 CCAAACACAGACACTCCTTATGG No data
1024587116_1024587119 5 Left 1024587116 7:50851534-50851556 CCTTCAATGAGTAAGAGTTGTCT No data
Right 1024587119 7:50851562-50851584 CCAAACACAGACACTCCTTATGG No data
1024587113_1024587119 20 Left 1024587113 7:50851519-50851541 CCAACTCCTACGCACCCTTCAAT No data
Right 1024587119 7:50851562-50851584 CCAAACACAGACACTCCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024587119 Original CRISPR CCAAACACAGACACTCCTTA TGG Intergenic
No off target data available for this crispr