ID: 1024587121

View in Genome Browser
Species Human (GRCh38)
Location 7:50851577-50851599
Sequence CCTTATGGAAAACCAAAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024587118_1024587121 -8 Left 1024587118 7:50851562-50851584 CCAAACACAGACACTCCTTATGG No data
Right 1024587121 7:50851577-50851599 CCTTATGGAAAACCAAAGAGAGG No data
1024587115_1024587121 21 Left 1024587115 7:50851533-50851555 CCCTTCAATGAGTAAGAGTTGTC No data
Right 1024587121 7:50851577-50851599 CCTTATGGAAAACCAAAGAGAGG No data
1024587116_1024587121 20 Left 1024587116 7:50851534-50851556 CCTTCAATGAGTAAGAGTTGTCT No data
Right 1024587121 7:50851577-50851599 CCTTATGGAAAACCAAAGAGAGG No data
1024587114_1024587121 29 Left 1024587114 7:50851525-50851547 CCTACGCACCCTTCAATGAGTAA No data
Right 1024587121 7:50851577-50851599 CCTTATGGAAAACCAAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024587121 Original CRISPR CCTTATGGAAAACCAAAGAG AGG Intergenic
No off target data available for this crispr