ID: 1024589701

View in Genome Browser
Species Human (GRCh38)
Location 7:50870738-50870760
Sequence ATTCCTGGAGTCACACATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024589699_1024589701 -1 Left 1024589699 7:50870716-50870738 CCAGATAAAGTAGTTGAAGTTTA No data
Right 1024589701 7:50870738-50870760 ATTCCTGGAGTCACACATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024589701 Original CRISPR ATTCCTGGAGTCACACATCC TGG Intergenic
No off target data available for this crispr