ID: 1024594178

View in Genome Browser
Species Human (GRCh38)
Location 7:50918212-50918234
Sequence CTGTAGCAGCAGAAGCTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024594175_1024594178 8 Left 1024594175 7:50918181-50918203 CCGAGTTTGCACCAAAAGACCAT No data
Right 1024594178 7:50918212-50918234 CTGTAGCAGCAGAAGCTAACTGG No data
1024594176_1024594178 -3 Left 1024594176 7:50918192-50918214 CCAAAAGACCATCAGAAAAGCTG No data
Right 1024594178 7:50918212-50918234 CTGTAGCAGCAGAAGCTAACTGG No data
1024594174_1024594178 26 Left 1024594174 7:50918163-50918185 CCAATGAGGAATCTAACACCGAG No data
Right 1024594178 7:50918212-50918234 CTGTAGCAGCAGAAGCTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024594178 Original CRISPR CTGTAGCAGCAGAAGCTAAC TGG Intergenic
No off target data available for this crispr