ID: 1024594281

View in Genome Browser
Species Human (GRCh38)
Location 7:50918831-50918853
Sequence TGGGAAGGTACCCGGACTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024594281_1024594292 7 Left 1024594281 7:50918831-50918853 CCCAGAGTCCGGGTACCTTCCCA No data
Right 1024594292 7:50918861-50918883 CAGACTCCCTGAGCCAGTGGAGG No data
1024594281_1024594293 10 Left 1024594281 7:50918831-50918853 CCCAGAGTCCGGGTACCTTCCCA No data
Right 1024594293 7:50918864-50918886 ACTCCCTGAGCCAGTGGAGGTGG No data
1024594281_1024594289 4 Left 1024594281 7:50918831-50918853 CCCAGAGTCCGGGTACCTTCCCA No data
Right 1024594289 7:50918858-50918880 CCCCAGACTCCCTGAGCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024594281 Original CRISPR TGGGAAGGTACCCGGACTCT GGG (reversed) Intergenic
No off target data available for this crispr