ID: 1024594558

View in Genome Browser
Species Human (GRCh38)
Location 7:50921154-50921176
Sequence ATGACCCCCTACAAGAGATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024594558_1024594561 18 Left 1024594558 7:50921154-50921176 CCCGATCTCTTGTAGGGGGTCAT No data
Right 1024594561 7:50921195-50921217 GACTTGAAGCACTATAAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024594558 Original CRISPR ATGACCCCCTACAAGAGATC GGG (reversed) Intergenic
No off target data available for this crispr