ID: 1024598490

View in Genome Browser
Species Human (GRCh38)
Location 7:50960064-50960086
Sequence GATCAGAGGAGGACTGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024598490_1024598498 23 Left 1024598490 7:50960064-50960086 CCCTCCACAGTCCTCCTCTGATC No data
Right 1024598498 7:50960110-50960132 GAACAAGAATTCATGGCATTTGG No data
1024598490_1024598496 1 Left 1024598490 7:50960064-50960086 CCCTCCACAGTCCTCCTCTGATC No data
Right 1024598496 7:50960088-50960110 TCACTTGCTCAGACATTCAGAGG No data
1024598490_1024598497 16 Left 1024598490 7:50960064-50960086 CCCTCCACAGTCCTCCTCTGATC No data
Right 1024598497 7:50960103-50960125 TTCAGAGGAACAAGAATTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024598490 Original CRISPR GATCAGAGGAGGACTGTGGA GGG (reversed) Intergenic
No off target data available for this crispr