ID: 1024601165

View in Genome Browser
Species Human (GRCh38)
Location 7:50982797-50982819
Sequence TATTACCTACTGCTTGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024601165_1024601168 -1 Left 1024601165 7:50982797-50982819 CCATCCACAAGCAGTAGGTAATA No data
Right 1024601168 7:50982819-50982841 AATGCAGAGACCAGAAAATAGGG No data
1024601165_1024601167 -2 Left 1024601165 7:50982797-50982819 CCATCCACAAGCAGTAGGTAATA No data
Right 1024601167 7:50982818-50982840 TAATGCAGAGACCAGAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024601165 Original CRISPR TATTACCTACTGCTTGTGGA TGG (reversed) Intergenic
No off target data available for this crispr