ID: 1024601165 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:50982797-50982819 |
| Sequence | TATTACCTACTGCTTGTGGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1024601165_1024601168 | -1 | Left | 1024601165 | 7:50982797-50982819 | CCATCCACAAGCAGTAGGTAATA | No data | ||
| Right | 1024601168 | 7:50982819-50982841 | AATGCAGAGACCAGAAAATAGGG | No data | ||||
| 1024601165_1024601167 | -2 | Left | 1024601165 | 7:50982797-50982819 | CCATCCACAAGCAGTAGGTAATA | No data | ||
| Right | 1024601167 | 7:50982818-50982840 | TAATGCAGAGACCAGAAAATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1024601165 | Original CRISPR | TATTACCTACTGCTTGTGGA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||