ID: 1024601181

View in Genome Browser
Species Human (GRCh38)
Location 7:50982896-50982918
Sequence CCACCAGCACAGTCCCTGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024601181_1024601185 10 Left 1024601181 7:50982896-50982918 CCGTGCAGGGACTGTGCTGGTGG No data
Right 1024601185 7:50982929-50982951 GTCAAGTTGACTGAGTCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024601181 Original CRISPR CCACCAGCACAGTCCCTGCA CGG (reversed) Intergenic
No off target data available for this crispr