ID: 1024602871

View in Genome Browser
Species Human (GRCh38)
Location 7:51000280-51000302
Sequence AGCTCTGTAGAGGGCCCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024602871_1024602876 23 Left 1024602871 7:51000280-51000302 CCAGAGGGGCCCTCTACAGAGCT No data
Right 1024602876 7:51000326-51000348 TCCTTCCCTTCTGTTCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024602871 Original CRISPR AGCTCTGTAGAGGGCCCCTC TGG (reversed) Intergenic
No off target data available for this crispr