ID: 1024602873

View in Genome Browser
Species Human (GRCh38)
Location 7:51000289-51000311
Sequence GAAAACCAGAGCTCTGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024602873_1024602876 14 Left 1024602873 7:51000289-51000311 CCCTCTACAGAGCTCTGGTTTTC No data
Right 1024602876 7:51000326-51000348 TCCTTCCCTTCTGTTCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024602873 Original CRISPR GAAAACCAGAGCTCTGTAGA GGG (reversed) Intergenic
No off target data available for this crispr