ID: 1024602875

View in Genome Browser
Species Human (GRCh38)
Location 7:51000313-51000335
Sequence AAGGGAAGGAGAGCTGCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024602875_1024602884 30 Left 1024602875 7:51000313-51000335 CCTTGTGCAGCTCTCCTTCCCTT No data
Right 1024602884 7:51000366-51000388 CTCTATTCAAGGAGTCCACCAGG No data
1024602875_1024602881 19 Left 1024602875 7:51000313-51000335 CCTTGTGCAGCTCTCCTTCCCTT No data
Right 1024602881 7:51000355-51000377 AGCTCCATCTCCTCTATTCAAGG No data
1024602875_1024602876 -10 Left 1024602875 7:51000313-51000335 CCTTGTGCAGCTCTCCTTCCCTT No data
Right 1024602876 7:51000326-51000348 TCCTTCCCTTCTGTTCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024602875 Original CRISPR AAGGGAAGGAGAGCTGCACA AGG (reversed) Intergenic
No off target data available for this crispr